Incidental Mutation 'R4739:Hectd4'
ID 359510
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene Name HECT domain E3 ubiquitin protein ligase 4
Synonyms Gm15800
MMRRC Submission 042025-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.925) question?
Stock # R4739 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 121358282-121506640 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121486505 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 3167 (M3167L)
Ref Sequence ENSEMBL: ENSMUSP00000048345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042614
AA Change: M3167L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: M3167L

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,796,904 (GRCm39) noncoding transcript Het
2300002M23Rik A G 17: 35,878,403 (GRCm39) probably benign Het
Aadat T C 8: 60,993,140 (GRCm39) V360A probably benign Het
Abcc5 T A 16: 20,218,376 (GRCm39) D283V probably damaging Het
Abraxas1 T A 5: 100,959,886 (GRCm39) K155N probably damaging Het
Acot3 T C 12: 84,105,364 (GRCm39) I277T probably benign Het
Ankrd45 G A 1: 160,982,960 (GRCm39) C157Y probably damaging Het
Apol10a C T 15: 77,372,841 (GRCm39) T159I possibly damaging Het
Arhgef11 G A 3: 87,605,306 (GRCm39) V214M possibly damaging Het
Ash1l A C 3: 88,890,152 (GRCm39) N677T probably benign Het
Atg13 A G 2: 91,515,040 (GRCm39) S254P probably damaging Het
Atg16l2 A G 7: 100,946,385 (GRCm39) L129P probably damaging Het
Avl9 T A 6: 56,703,294 (GRCm39) V120D probably damaging Het
Castor1 A G 11: 4,169,004 (GRCm39) E57G possibly damaging Het
Cc2d1b T C 4: 108,485,239 (GRCm39) V527A probably benign Het
Ccnl1 A G 3: 65,854,092 (GRCm39) probably benign Het
Cenpl T A 1: 160,910,837 (GRCm39) D261E probably damaging Het
Cep192 T G 18: 67,984,803 (GRCm39) I1604M probably benign Het
Cep95 A G 11: 106,706,560 (GRCm39) I573V probably benign Het
Cfap100 A G 6: 90,389,825 (GRCm39) probably null Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cmc1 T A 9: 117,904,245 (GRCm39) M49L probably benign Het
Cyfip2 G T 11: 46,170,820 (GRCm39) N176K probably damaging Het
Cyp2w1 T C 5: 139,342,430 (GRCm39) F408L probably damaging Het
D630045J12Rik G A 6: 38,172,971 (GRCm39) S399F possibly damaging Het
Dcbld2 T A 16: 58,281,339 (GRCm39) L528Q probably damaging Het
Dip2b T C 15: 100,105,658 (GRCm39) V1138A probably damaging Het
Dip2c T A 13: 9,583,375 (GRCm39) L119Q probably damaging Het
Dnah3 T C 7: 119,677,169 (GRCm39) D444G possibly damaging Het
Dsg1c A T 18: 20,408,246 (GRCm39) N432Y possibly damaging Het
Dst T A 1: 34,230,228 (GRCm39) I2785N probably benign Het
Dynap A T 18: 70,374,296 (GRCm39) Y77N possibly damaging Het
Eif4g3 T C 4: 137,910,510 (GRCm39) L1330P possibly damaging Het
Eif4g3 T A 4: 137,925,408 (GRCm39) S1584T probably benign Het
Enpp1 A T 10: 24,555,146 (GRCm39) C67S probably null Het
Enpp5 C T 17: 44,392,027 (GRCm39) T152I probably damaging Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Erc2 T G 14: 27,498,838 (GRCm39) L238R probably damaging Het
Eya3 T A 4: 132,448,698 (GRCm39) probably benign Het
Farp1 T C 14: 121,476,199 (GRCm39) F339L probably damaging Het
Fsip2 A C 2: 82,805,697 (GRCm39) D672A possibly damaging Het
Gap43 G T 16: 42,112,581 (GRCm39) P60Q probably benign Het
Gpr37l1 T A 1: 135,094,783 (GRCm39) I154F probably damaging Het
Greb1 A G 12: 16,746,329 (GRCm39) S1314P probably damaging Het
Hps3 C T 3: 20,084,574 (GRCm39) probably null Het
Hps5 A G 7: 46,436,013 (GRCm39) C178R probably benign Het
Hspg2 T A 4: 137,297,384 (GRCm39) probably benign Het
Impdh2-ps A G 8: 100,757,839 (GRCm39) noncoding transcript Het
Josd2 T A 7: 44,120,678 (GRCm39) N138K probably damaging Het
Mtmr6 T G 14: 60,529,546 (GRCm39) M315R probably damaging Het
Mtrf1 G A 14: 79,650,520 (GRCm39) V323M probably damaging Het
Myo16 G T 8: 10,423,527 (GRCm39) G288W probably damaging Het
Myo18a T C 11: 77,714,149 (GRCm39) Y748H probably damaging Het
Nek1 A T 8: 61,551,545 (GRCm39) N853I probably benign Het
Npnt T G 3: 132,610,452 (GRCm39) T272P possibly damaging Het
Obi1 C T 14: 104,747,819 (GRCm39) D43N probably damaging Het
Or2ag1b C A 7: 106,288,351 (GRCm39) E196* probably null Het
Or2b6 T A 13: 21,823,340 (GRCm39) M118L possibly damaging Het
Or2y17 G A 11: 49,232,148 (GRCm39) G263D probably benign Het
Or51e1 T A 7: 102,359,378 (GRCm39) I304N probably damaging Het
Or52n2c G A 7: 104,574,017 (GRCm39) T318I possibly damaging Het
Or5a1 A G 19: 12,097,234 (GRCm39) Y269H possibly damaging Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Pappa2 T G 1: 158,784,572 (GRCm39) D146A probably damaging Het
Pcsk9 C T 4: 106,304,353 (GRCm39) G496R probably damaging Het
Pes1 A G 11: 3,914,058 (GRCm39) K8E probably damaging Het
Phlpp2 G A 8: 110,667,052 (GRCm39) G1194S probably damaging Het
Pkn1 A C 8: 84,398,378 (GRCm39) V763G probably damaging Het
Pkp2 C A 16: 16,048,588 (GRCm39) A331E probably damaging Het
Plb1 T A 5: 32,507,023 (GRCm39) probably null Het
Plxna1 A T 6: 89,309,657 (GRCm39) probably null Het
Polq C T 16: 36,862,109 (GRCm39) T264M probably damaging Het
Prkag3 T C 1: 74,779,864 (GRCm39) *490W probably null Het
Prl2c1 T C 13: 28,041,661 (GRCm39) C228R probably damaging Het
Pus7l T C 15: 94,438,591 (GRCm39) S85G probably benign Het
Rfc3 A C 5: 151,568,241 (GRCm39) probably benign Het
Riox2 A G 16: 59,309,732 (GRCm39) N362S probably benign Het
Scaper A T 9: 55,650,932 (GRCm39) D904E probably damaging Het
Scn11a T C 9: 119,583,627 (GRCm39) M1663V probably benign Het
Slc13a3 A T 2: 165,272,209 (GRCm39) I278N possibly damaging Het
Slc22a7 T C 17: 46,745,923 (GRCm39) E278G probably damaging Het
Snrnp48 T A 13: 38,393,893 (GRCm39) M66K probably damaging Het
Styk1 T G 6: 131,277,429 (GRCm39) E404A probably damaging Het
Synj1 T A 16: 90,752,307 (GRCm39) H1016L probably benign Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tjp2 T C 19: 24,097,475 (GRCm39) probably null Het
Tmem87a A G 2: 120,190,518 (GRCm39) probably null Het
Trappc9 T G 15: 72,808,909 (GRCm39) Y718S probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Ugt2a3 C T 5: 87,475,054 (GRCm39) G397R probably damaging Het
Wdr33 T A 18: 32,019,139 (GRCm39) M454K probably benign Het
Wdtc1 G T 4: 133,029,110 (GRCm39) N325K possibly damaging Het
Whrn T C 4: 63,336,402 (GRCm39) H720R probably damaging Het
Xirp2 A T 2: 67,349,609 (GRCm39) D3268V probably damaging Het
Zc3h7a A T 16: 10,959,573 (GRCm39) H793Q probably damaging Het
Zfp518b C T 5: 38,831,841 (GRCm39) A55T possibly damaging Het
Zmynd8 G A 2: 165,647,249 (GRCm39) T901M probably damaging Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121,501,933 (GRCm39) missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121,487,169 (GRCm39) missense probably benign 0.18
IGL01085:Hectd4 APN 5 121,469,764 (GRCm39) missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121,445,013 (GRCm39) missense probably benign 0.01
IGL01402:Hectd4 APN 5 121,477,480 (GRCm39) splice site probably benign
IGL01474:Hectd4 APN 5 121,474,712 (GRCm39) missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121,456,714 (GRCm39) missense probably benign 0.28
IGL01548:Hectd4 APN 5 121,502,723 (GRCm39) missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121,460,763 (GRCm39) missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121,482,887 (GRCm39) missense probably benign 0.28
IGL01819:Hectd4 APN 5 121,466,481 (GRCm39) missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121,504,669 (GRCm39) utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121,430,150 (GRCm39) missense probably benign 0.33
IGL02490:Hectd4 APN 5 121,456,676 (GRCm39) missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121,482,848 (GRCm39) missense probably benign 0.28
IGL02626:Hectd4 APN 5 121,491,944 (GRCm39) missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121,487,465 (GRCm39) missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121,480,782 (GRCm39) missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121,445,067 (GRCm39) missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121,486,857 (GRCm39) missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121,503,116 (GRCm39) missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121,397,942 (GRCm39) missense probably benign
IGL03181:Hectd4 APN 5 121,492,021 (GRCm39) missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121,398,002 (GRCm39) splice site probably benign
IGL03375:Hectd4 APN 5 121,466,445 (GRCm39) missense possibly damaging 0.72
Achilles UTSW 5 121,445,444 (GRCm39) nonsense probably null
agamemnon UTSW 5 121,391,921 (GRCm39) splice site probably benign
clymnestra UTSW 5 121,472,438 (GRCm39) missense possibly damaging 0.86
hector UTSW 5 121,453,500 (GRCm39) missense probably damaging 1.00
helen UTSW 5 121,448,726 (GRCm39) missense probably damaging 0.97
Merriwether UTSW 5 121,491,614 (GRCm39) missense possibly damaging 0.53
PIT4466001:Hectd4 UTSW 5 121,471,123 (GRCm39) critical splice donor site probably null
R0018:Hectd4 UTSW 5 121,392,242 (GRCm39) missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121,446,639 (GRCm39) missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121,400,651 (GRCm39) nonsense probably null
R0080:Hectd4 UTSW 5 121,487,435 (GRCm39) missense probably benign 0.18
R0110:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0110:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0115:Hectd4 UTSW 5 121,433,569 (GRCm39) splice site probably benign
R0128:Hectd4 UTSW 5 121,487,306 (GRCm39) missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0131:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0132:Hectd4 UTSW 5 121,471,087 (GRCm39) missense probably benign 0.44
R0244:Hectd4 UTSW 5 121,467,668 (GRCm39) missense probably benign 0.33
R0281:Hectd4 UTSW 5 121,392,314 (GRCm39) missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121,397,927 (GRCm39) missense probably benign
R0410:Hectd4 UTSW 5 121,424,329 (GRCm39) missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121,481,145 (GRCm39) splice site probably null
R0442:Hectd4 UTSW 5 121,462,045 (GRCm39) missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121,502,653 (GRCm39) splice site probably null
R0469:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0469:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0481:Hectd4 UTSW 5 121,433,569 (GRCm39) splice site probably benign
R0510:Hectd4 UTSW 5 121,443,736 (GRCm39) missense possibly damaging 0.53
R0510:Hectd4 UTSW 5 121,419,959 (GRCm39) missense possibly damaging 0.90
R0520:Hectd4 UTSW 5 121,469,770 (GRCm39) missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121,486,539 (GRCm39) missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121,442,400 (GRCm39) missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121,481,295 (GRCm39) splice site probably benign
R0622:Hectd4 UTSW 5 121,486,688 (GRCm39) missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121,415,887 (GRCm39) missense probably benign 0.18
R0708:Hectd4 UTSW 5 121,424,526 (GRCm39) critical splice donor site probably null
R0710:Hectd4 UTSW 5 121,474,691 (GRCm39) missense probably benign 0.08
R0763:Hectd4 UTSW 5 121,445,096 (GRCm39) unclassified probably benign
R0764:Hectd4 UTSW 5 121,424,832 (GRCm39) missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121,424,799 (GRCm39) missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121,448,662 (GRCm39) missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121,488,548 (GRCm39) missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121,459,570 (GRCm39) missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121,456,687 (GRCm39) nonsense probably null
R1391:Hectd4 UTSW 5 121,491,758 (GRCm39) missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121,466,576 (GRCm39) critical splice donor site probably null
R1468:Hectd4 UTSW 5 121,487,235 (GRCm39) missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121,487,235 (GRCm39) missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121,462,019 (GRCm39) missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121,487,322 (GRCm39) missense probably benign 0.00
R1572:Hectd4 UTSW 5 121,439,941 (GRCm39) missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121,455,308 (GRCm39) missense probably benign 0.01
R1705:Hectd4 UTSW 5 121,436,167 (GRCm39) missense probably benign
R1715:Hectd4 UTSW 5 121,482,881 (GRCm39) missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121,439,902 (GRCm39) missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121,487,593 (GRCm39) missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121,496,366 (GRCm39) missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121,429,254 (GRCm39) splice site probably benign
R1784:Hectd4 UTSW 5 121,439,902 (GRCm39) missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121,435,243 (GRCm39) missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.08
R1915:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.08
R2024:Hectd4 UTSW 5 121,419,981 (GRCm39) missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121,493,692 (GRCm39) missense probably benign 0.04
R2108:Hectd4 UTSW 5 121,471,487 (GRCm39) missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121,456,702 (GRCm39) missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121,391,921 (GRCm39) splice site probably benign
R2192:Hectd4 UTSW 5 121,453,206 (GRCm39) missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121,491,600 (GRCm39) missense probably benign 0.18
R2324:Hectd4 UTSW 5 121,453,500 (GRCm39) missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121,458,089 (GRCm39) missense probably benign 0.05
R2504:Hectd4 UTSW 5 121,402,030 (GRCm39) missense possibly damaging 0.73
R2504:Hectd4 UTSW 5 121,358,683 (GRCm39) missense unknown
R2904:Hectd4 UTSW 5 121,430,787 (GRCm39) splice site probably benign
R3843:Hectd4 UTSW 5 121,397,936 (GRCm39) missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121,458,164 (GRCm39) critical splice donor site probably null
R3944:Hectd4 UTSW 5 121,441,588 (GRCm39) splice site probably benign
R4133:Hectd4 UTSW 5 121,415,897 (GRCm39) critical splice donor site probably null
R4271:Hectd4 UTSW 5 121,358,567 (GRCm39) small deletion probably benign
R4413:Hectd4 UTSW 5 121,488,544 (GRCm39) missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121,446,334 (GRCm39) missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121,424,320 (GRCm39) missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121,452,970 (GRCm39) nonsense probably null
R4564:Hectd4 UTSW 5 121,488,494 (GRCm39) missense probably benign 0.33
R4582:Hectd4 UTSW 5 121,424,482 (GRCm39) missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121,435,266 (GRCm39) missense probably benign 0.01
R4633:Hectd4 UTSW 5 121,487,279 (GRCm39) missense probably benign 0.33
R4643:Hectd4 UTSW 5 121,487,118 (GRCm39) missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121,463,314 (GRCm39) missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121,441,678 (GRCm39) missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121,480,040 (GRCm39) missense possibly damaging 0.53
R4781:Hectd4 UTSW 5 121,444,170 (GRCm39) critical splice donor site probably null
R4860:Hectd4 UTSW 5 121,443,881 (GRCm39) missense probably benign 0.04
R4860:Hectd4 UTSW 5 121,443,881 (GRCm39) missense probably benign 0.04
R4869:Hectd4 UTSW 5 121,460,735 (GRCm39) missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121,401,954 (GRCm39) missense probably benign 0.18
R4922:Hectd4 UTSW 5 121,497,378 (GRCm39) missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121,460,753 (GRCm39) missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121,467,628 (GRCm39) missense possibly damaging 0.93
R5004:Hectd4 UTSW 5 121,466,262 (GRCm39) splice site probably null
R5129:Hectd4 UTSW 5 121,481,573 (GRCm39) missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121,491,614 (GRCm39) missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121,482,887 (GRCm39) missense probably benign 0.28
R5344:Hectd4 UTSW 5 121,481,739 (GRCm39) missense probably benign 0.28
R5345:Hectd4 UTSW 5 121,402,037 (GRCm39) missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121,442,511 (GRCm39) missense probably benign 0.33
R5360:Hectd4 UTSW 5 121,453,464 (GRCm39) missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121,448,666 (GRCm39) missense probably benign 0.04
R5445:Hectd4 UTSW 5 121,404,337 (GRCm39) missense probably benign 0.00
R5479:Hectd4 UTSW 5 121,445,011 (GRCm39) missense probably benign
R5507:Hectd4 UTSW 5 121,419,164 (GRCm39) missense unknown
R5552:Hectd4 UTSW 5 121,480,914 (GRCm39) missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121,486,878 (GRCm39) missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121,491,565 (GRCm39) missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121,486,682 (GRCm39) missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121,445,587 (GRCm39) critical splice donor site probably null
R5869:Hectd4 UTSW 5 121,481,288 (GRCm39) critical splice donor site probably null
R5913:Hectd4 UTSW 5 121,462,037 (GRCm39) missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121,446,334 (GRCm39) missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121,460,357 (GRCm39) missense probably benign 0.01
R6219:Hectd4 UTSW 5 121,446,941 (GRCm39) missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121,477,561 (GRCm39) missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121,392,283 (GRCm39) missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121,488,508 (GRCm39) missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121,472,438 (GRCm39) missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121,488,655 (GRCm39) missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121,494,259 (GRCm39) splice site probably null
R6540:Hectd4 UTSW 5 121,441,634 (GRCm39) missense probably benign 0.33
R6706:Hectd4 UTSW 5 121,458,147 (GRCm39) missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121,445,444 (GRCm39) nonsense probably null
R6736:Hectd4 UTSW 5 121,415,788 (GRCm39) missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121,491,574 (GRCm39) missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121,502,631 (GRCm39) missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121,437,660 (GRCm39) missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121,411,692 (GRCm39) missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121,446,405 (GRCm39) missense probably benign 0.01
R7234:Hectd4 UTSW 5 121,467,136 (GRCm39) missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121,452,944 (GRCm39) missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121,448,726 (GRCm39) missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121,419,995 (GRCm39) missense probably benign 0.00
R7467:Hectd4 UTSW 5 121,462,024 (GRCm39) missense possibly damaging 0.66
R7475:Hectd4 UTSW 5 121,496,196 (GRCm39) splice site probably null
R7482:Hectd4 UTSW 5 121,501,941 (GRCm39) missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121,435,172 (GRCm39) missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121,481,728 (GRCm39) missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121,453,573 (GRCm39) splice site probably null
R7560:Hectd4 UTSW 5 121,392,405 (GRCm39) missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121,429,288 (GRCm39) missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121,487,522 (GRCm39) missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121,456,798 (GRCm39) missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121,392,434 (GRCm39) missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121,462,094 (GRCm39) missense probably benign 0.06
R7692:Hectd4 UTSW 5 121,459,627 (GRCm39) missense possibly damaging 0.46
R7725:Hectd4 UTSW 5 121,358,680 (GRCm39) missense unknown
R7731:Hectd4 UTSW 5 121,445,077 (GRCm39) missense probably benign 0.00
R7732:Hectd4 UTSW 5 121,474,692 (GRCm39) missense probably benign 0.14
R7782:Hectd4 UTSW 5 121,443,784 (GRCm39) missense possibly damaging 0.53
R7854:Hectd4 UTSW 5 121,467,631 (GRCm39) missense probably benign 0.27
R7898:Hectd4 UTSW 5 121,469,880 (GRCm39) missense probably benign 0.18
R7910:Hectd4 UTSW 5 121,392,291 (GRCm39) missense possibly damaging 0.86
R7962:Hectd4 UTSW 5 121,448,692 (GRCm39) missense probably damaging 0.98
R8003:Hectd4 UTSW 5 121,477,581 (GRCm39) missense possibly damaging 0.85
R8098:Hectd4 UTSW 5 121,459,461 (GRCm39) missense possibly damaging 0.46
R8110:Hectd4 UTSW 5 121,471,012 (GRCm39) missense possibly damaging 0.96
R8118:Hectd4 UTSW 5 121,424,439 (GRCm39) missense probably benign 0.33
R8171:Hectd4 UTSW 5 121,456,819 (GRCm39) missense possibly damaging 0.82
R8234:Hectd4 UTSW 5 121,477,607 (GRCm39) missense possibly damaging 0.72
R8289:Hectd4 UTSW 5 121,404,424 (GRCm39) missense possibly damaging 0.53
R8292:Hectd4 UTSW 5 121,455,288 (GRCm39) missense possibly damaging 0.66
R8348:Hectd4 UTSW 5 121,358,319 (GRCm39) start gained probably benign
R8397:Hectd4 UTSW 5 121,397,957 (GRCm39) missense probably damaging 0.98
R8436:Hectd4 UTSW 5 121,446,421 (GRCm39) missense possibly damaging 0.90
R8436:Hectd4 UTSW 5 121,481,210 (GRCm39) missense probably benign 0.00
R8443:Hectd4 UTSW 5 121,467,172 (GRCm39) missense possibly damaging 0.72
R8448:Hectd4 UTSW 5 121,358,319 (GRCm39) start gained probably benign
R8516:Hectd4 UTSW 5 121,487,073 (GRCm39) missense possibly damaging 0.53
R8519:Hectd4 UTSW 5 121,442,489 (GRCm39) nonsense probably null
R8553:Hectd4 UTSW 5 121,491,661 (GRCm39) missense possibly damaging 0.73
R8557:Hectd4 UTSW 5 121,448,714 (GRCm39) missense possibly damaging 0.66
R8725:Hectd4 UTSW 5 121,488,557 (GRCm39) missense probably damaging 1.00
R8751:Hectd4 UTSW 5 121,501,838 (GRCm39) nonsense probably null
R8769:Hectd4 UTSW 5 121,419,936 (GRCm39) missense possibly damaging 0.53
R8803:Hectd4 UTSW 5 121,461,994 (GRCm39) missense probably benign 0.01
R8887:Hectd4 UTSW 5 121,433,541 (GRCm39) missense probably benign 0.44
R8982:Hectd4 UTSW 5 121,466,305 (GRCm39) missense probably benign 0.02
R8988:Hectd4 UTSW 5 121,415,819 (GRCm39) missense possibly damaging 0.86
R8991:Hectd4 UTSW 5 121,496,347 (GRCm39) missense probably benign 0.33
R8994:Hectd4 UTSW 5 121,441,629 (GRCm39) missense probably benign 0.33
R8995:Hectd4 UTSW 5 121,392,422 (GRCm39) missense possibly damaging 0.96
R9049:Hectd4 UTSW 5 121,451,955 (GRCm39) missense possibly damaging 0.92
R9093:Hectd4 UTSW 5 121,411,677 (GRCm39) missense probably benign 0.14
R9106:Hectd4 UTSW 5 121,467,619 (GRCm39) missense possibly damaging 0.53
R9137:Hectd4 UTSW 5 121,496,238 (GRCm39) missense possibly damaging 0.53
R9146:Hectd4 UTSW 5 121,487,097 (GRCm39) missense probably benign 0.33
R9154:Hectd4 UTSW 5 121,391,967 (GRCm39) missense
R9162:Hectd4 UTSW 5 121,445,042 (GRCm39) missense possibly damaging 0.66
R9166:Hectd4 UTSW 5 121,446,690 (GRCm39) missense probably damaging 0.96
R9183:Hectd4 UTSW 5 121,437,551 (GRCm39) missense possibly damaging 0.51
R9207:Hectd4 UTSW 5 121,433,496 (GRCm39) missense possibly damaging 0.86
R9291:Hectd4 UTSW 5 121,487,028 (GRCm39) missense probably benign 0.14
R9300:Hectd4 UTSW 5 121,486,952 (GRCm39) missense probably benign 0.33
R9314:Hectd4 UTSW 5 121,437,708 (GRCm39) critical splice donor site probably null
R9381:Hectd4 UTSW 5 121,472,492 (GRCm39) missense possibly damaging 0.53
R9432:Hectd4 UTSW 5 121,460,864 (GRCm39) missense probably benign 0.01
R9491:Hectd4 UTSW 5 121,452,981 (GRCm39) missense probably damaging 0.97
R9532:Hectd4 UTSW 5 121,502,616 (GRCm39) missense probably benign 0.00
R9557:Hectd4 UTSW 5 121,459,617 (GRCm39) missense possibly damaging 0.66
R9561:Hectd4 UTSW 5 121,472,532 (GRCm39) missense possibly damaging 0.53
R9593:Hectd4 UTSW 5 121,424,844 (GRCm39) nonsense probably null
R9704:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9705:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9712:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9713:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9726:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9732:Hectd4 UTSW 5 121,392,254 (GRCm39) nonsense probably null
R9750:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9752:Hectd4 UTSW 5 121,472,415 (GRCm39) missense possibly damaging 0.85
R9752:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
R9772:Hectd4 UTSW 5 121,448,744 (GRCm39) missense probably benign 0.00
X0026:Hectd4 UTSW 5 121,487,700 (GRCm39) missense probably benign 0.04
X0027:Hectd4 UTSW 5 121,459,467 (GRCm39) missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121,433,566 (GRCm39) splice site probably null
Z1177:Hectd4 UTSW 5 121,496,383 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCGTCCTGTATCTTGGGAAATAG -3'
(R):5'- CCTCGTCATACAGCTTATGCAG -3'

Sequencing Primer
(F):5'- AAGCAGTGCTGTCTGTCC -3'
(R):5'- AGCTCTGACTGTAAGGCCATCAG -3'
Posted On 2015-11-11