Incidental Mutation 'R4739:Plxna1'
ID 359515
Institutional Source Beutler Lab
Gene Symbol Plxna1
Ensembl Gene ENSMUSG00000030084
Gene Name plexin A1
Synonyms NOV, Plxn1, PlexA1, 2600013D04Rik
MMRRC Submission 042025-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.885) question?
Stock # R4739 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 89316314-89362620 bp(-) (GRCm38)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) A to T at 89332675 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000049845] [ENSMUST00000163139] [ENSMUST00000163139]
AlphaFold P70206
Predicted Effect probably null
Transcript: ENSMUST00000049845
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000049845
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163139
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163139
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204997
Predicted Effect probably benign
Transcript: ENSMUST00000205121
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,969,334 (GRCm38) noncoding transcript Het
2300002M23Rik A G 17: 35,567,506 (GRCm38) probably benign Het
Aadat T C 8: 60,540,106 (GRCm38) V360A probably benign Het
Abcc5 T A 16: 20,399,626 (GRCm38) D283V probably damaging Het
Abraxas1 T A 5: 100,812,020 (GRCm38) K155N probably damaging Het
Acot3 T C 12: 84,058,590 (GRCm38) I277T probably benign Het
Ankrd45 G A 1: 161,155,390 (GRCm38) C157Y probably damaging Het
Apol10a C T 15: 77,488,641 (GRCm38) T159I possibly damaging Het
Arhgef11 G A 3: 87,697,999 (GRCm38) V214M possibly damaging Het
Ash1l A C 3: 88,982,845 (GRCm38) N677T probably benign Het
Atg13 A G 2: 91,684,695 (GRCm38) S254P probably damaging Het
Atg16l2 A G 7: 101,297,178 (GRCm38) L129P probably damaging Het
Avl9 T A 6: 56,726,309 (GRCm38) V120D probably damaging Het
Castor1 A G 11: 4,219,004 (GRCm38) E57G possibly damaging Het
Cc2d1b T C 4: 108,628,042 (GRCm38) V527A probably benign Het
Ccnl1 A G 3: 65,946,671 (GRCm38) probably benign Het
Cenpl T A 1: 161,083,267 (GRCm38) D261E probably damaging Het
Cep192 T G 18: 67,851,732 (GRCm38) I1604M probably benign Het
Cep95 A G 11: 106,815,734 (GRCm38) I573V probably benign Het
Cfap100 A G 6: 90,412,843 (GRCm38) probably null Het
Ciao3 A T 17: 25,781,309 (GRCm38) H322L probably damaging Het
Cmc1 T A 9: 118,075,177 (GRCm38) M49L probably benign Het
Cyfip2 G T 11: 46,279,993 (GRCm38) N176K probably damaging Het
Cyp2w1 T C 5: 139,356,675 (GRCm38) F408L probably damaging Het
D630045J12Rik G A 6: 38,196,036 (GRCm38) S399F possibly damaging Het
Dcbld2 T A 16: 58,460,976 (GRCm38) L528Q probably damaging Het
Dip2b T C 15: 100,207,777 (GRCm38) V1138A probably damaging Het
Dip2c T A 13: 9,533,339 (GRCm38) L119Q probably damaging Het
Dnah3 T C 7: 120,077,946 (GRCm38) D444G possibly damaging Het
Dsg1c A T 18: 20,275,189 (GRCm38) N432Y possibly damaging Het
Dst T A 1: 34,191,147 (GRCm38) I2785N probably benign Het
Dynap A T 18: 70,241,225 (GRCm38) Y77N possibly damaging Het
Eif4g3 T C 4: 138,183,199 (GRCm38) L1330P possibly damaging Het
Eif4g3 T A 4: 138,198,097 (GRCm38) S1584T probably benign Het
Enpp1 A T 10: 24,679,248 (GRCm38) C67S probably null Het
Enpp5 C T 17: 44,081,136 (GRCm38) T152I probably damaging Het
Erbb4 T C 1: 68,343,900 (GRCm38) M313V probably damaging Het
Erc2 T G 14: 27,776,881 (GRCm38) L238R probably damaging Het
Eya3 T A 4: 132,721,387 (GRCm38) probably benign Het
Farp1 T C 14: 121,238,787 (GRCm38) F339L probably damaging Het
Fsip2 A C 2: 82,975,353 (GRCm38) D672A possibly damaging Het
Gap43 G T 16: 42,292,218 (GRCm38) P60Q probably benign Het
Gpr37l1 T A 1: 135,167,045 (GRCm38) I154F probably damaging Het
Greb1 A G 12: 16,696,328 (GRCm38) S1314P probably damaging Het
Hectd4 A T 5: 121,348,442 (GRCm38) M3167L probably benign Het
Hps3 C T 3: 20,030,410 (GRCm38) probably null Het
Hps5 A G 7: 46,786,589 (GRCm38) C178R probably benign Het
Hspg2 T A 4: 137,570,073 (GRCm38) probably benign Het
Impdh2-ps A G 8: 100,031,207 (GRCm38) noncoding transcript Het
Josd2 T A 7: 44,471,254 (GRCm38) N138K probably damaging Het
Mtmr6 T G 14: 60,292,097 (GRCm38) M315R probably damaging Het
Mtrf1 G A 14: 79,413,080 (GRCm38) V323M probably damaging Het
Myo16 G T 8: 10,373,527 (GRCm38) G288W probably damaging Het
Myo18a T C 11: 77,823,323 (GRCm38) Y748H probably damaging Het
Nek1 A T 8: 61,098,511 (GRCm38) N853I probably benign Het
Npnt T G 3: 132,904,691 (GRCm38) T272P possibly damaging Het
Or2ag1b C A 7: 106,689,144 (GRCm38) E196* probably null Het
Or2b6 T A 13: 21,639,170 (GRCm38) M118L possibly damaging Het
Or2y17 G A 11: 49,341,321 (GRCm38) G263D probably benign Het
Or51e1 T A 7: 102,710,171 (GRCm38) I304N probably damaging Het
Or52n2c G A 7: 104,924,810 (GRCm38) T318I possibly damaging Het
Or5a1 A G 19: 12,119,870 (GRCm38) Y269H possibly damaging Het
Pappa2 T G 1: 158,957,002 (GRCm38) D146A probably damaging Het
Pappa2 T C 1: 158,957,012 (GRCm38) R143G probably benign Het
Pcsk9 C T 4: 106,447,156 (GRCm38) G496R probably damaging Het
Pes1 A G 11: 3,964,058 (GRCm38) K8E probably damaging Het
Phlpp2 G A 8: 109,940,420 (GRCm38) G1194S probably damaging Het
Pkn1 A C 8: 83,671,749 (GRCm38) V763G probably damaging Het
Pkp2 C A 16: 16,230,724 (GRCm38) A331E probably damaging Het
Plb1 T A 5: 32,349,679 (GRCm38) probably null Het
Polq C T 16: 37,041,747 (GRCm38) T264M probably damaging Het
Prkag3 T C 1: 74,740,705 (GRCm38) *490W probably null Het
Prl2c1 T C 13: 27,857,678 (GRCm38) C228R probably damaging Het
Pus7l T C 15: 94,540,710 (GRCm38) S85G probably benign Het
Rfc3 A C 5: 151,644,776 (GRCm38) probably benign Het
Riox2 A G 16: 59,489,369 (GRCm38) N362S probably benign Het
Rnf219 C T 14: 104,510,383 (GRCm38) D43N probably damaging Het
Scaper A T 9: 55,743,648 (GRCm38) D904E probably damaging Het
Scn11a T C 9: 119,754,561 (GRCm38) M1663V probably benign Het
Slc13a3 A T 2: 165,430,289 (GRCm38) I278N possibly damaging Het
Slc22a7 T C 17: 46,434,997 (GRCm38) E278G probably damaging Het
Snrnp48 T A 13: 38,209,917 (GRCm38) M66K probably damaging Het
Styk1 T G 6: 131,300,466 (GRCm38) E404A probably damaging Het
Synj1 T A 16: 90,955,419 (GRCm38) H1016L probably benign Het
Tbc1d8 G A 1: 39,402,878 (GRCm38) T211I possibly damaging Het
Tjp2 T C 19: 24,120,111 (GRCm38) probably null Het
Tmem87a A G 2: 120,360,037 (GRCm38) probably null Het
Trappc9 T G 15: 72,937,060 (GRCm38) Y718S probably damaging Het
Ttn A T 2: 76,811,243 (GRCm38) L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 (GRCm38) V191M probably benign Het
Ugt2a3 C T 5: 87,327,195 (GRCm38) G397R probably damaging Het
Wdr33 T A 18: 31,886,086 (GRCm38) M454K probably benign Het
Wdtc1 G T 4: 133,301,799 (GRCm38) N325K possibly damaging Het
Whrn T C 4: 63,418,165 (GRCm38) H720R probably damaging Het
Xirp2 A T 2: 67,519,265 (GRCm38) D3268V probably damaging Het
Zc3h7a A T 16: 11,141,709 (GRCm38) H793Q probably damaging Het
Zfp518b C T 5: 38,674,498 (GRCm38) A55T possibly damaging Het
Zmynd8 G A 2: 165,805,329 (GRCm38) T901M probably damaging Het
Other mutations in Plxna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Plxna1 APN 6 89,320,998 (GRCm38) missense probably damaging 1.00
IGL01358:Plxna1 APN 6 89,322,750 (GRCm38) missense probably damaging 1.00
IGL01475:Plxna1 APN 6 89,354,888 (GRCm38) missense possibly damaging 0.92
IGL01480:Plxna1 APN 6 89,344,096 (GRCm38) missense possibly damaging 0.70
IGL01585:Plxna1 APN 6 89,329,556 (GRCm38) critical splice donor site probably null
IGL01804:Plxna1 APN 6 89,329,646 (GRCm38) missense probably damaging 1.00
IGL01909:Plxna1 APN 6 89,332,084 (GRCm38) critical splice donor site probably null
IGL01989:Plxna1 APN 6 89,329,414 (GRCm38) nonsense probably null
IGL02015:Plxna1 APN 6 89,342,451 (GRCm38) missense probably damaging 1.00
IGL02023:Plxna1 APN 6 89,357,332 (GRCm38) missense possibly damaging 0.88
IGL02668:Plxna1 APN 6 89,357,269 (GRCm38) nonsense probably null
IGL02703:Plxna1 APN 6 89,356,943 (GRCm38) missense probably damaging 1.00
IGL02954:Plxna1 APN 6 89,324,667 (GRCm38) missense probably damaging 1.00
IGL03212:Plxna1 APN 6 89,331,903 (GRCm38) missense probably damaging 1.00
PIT4544001:Plxna1 UTSW 6 89,357,429 (GRCm38) missense probably benign 0.14
R0055:Plxna1 UTSW 6 89,329,739 (GRCm38) missense possibly damaging 0.94
R0055:Plxna1 UTSW 6 89,329,739 (GRCm38) missense possibly damaging 0.94
R0147:Plxna1 UTSW 6 89,320,710 (GRCm38) missense possibly damaging 0.95
R0149:Plxna1 UTSW 6 89,320,613 (GRCm38) missense probably null 0.95
R0166:Plxna1 UTSW 6 89,333,019 (GRCm38) missense probably damaging 1.00
R0200:Plxna1 UTSW 6 89,323,593 (GRCm38) missense probably damaging 1.00
R0415:Plxna1 UTSW 6 89,357,336 (GRCm38) missense probably benign 0.12
R0841:Plxna1 UTSW 6 89,332,204 (GRCm38) missense probably damaging 1.00
R1018:Plxna1 UTSW 6 89,342,960 (GRCm38) missense probably damaging 1.00
R1240:Plxna1 UTSW 6 89,321,050 (GRCm38) missense probably damaging 1.00
R1355:Plxna1 UTSW 6 89,320,766 (GRCm38) unclassified probably benign
R1700:Plxna1 UTSW 6 89,357,008 (GRCm38) missense probably damaging 1.00
R1776:Plxna1 UTSW 6 89,335,464 (GRCm38) missense probably benign 0.00
R1957:Plxna1 UTSW 6 89,331,291 (GRCm38) missense probably damaging 1.00
R2314:Plxna1 UTSW 6 89,324,316 (GRCm38) missense probably damaging 1.00
R2968:Plxna1 UTSW 6 89,342,608 (GRCm38) missense probably damaging 1.00
R3118:Plxna1 UTSW 6 89,356,976 (GRCm38) missense possibly damaging 0.89
R3522:Plxna1 UTSW 6 89,337,353 (GRCm38) critical splice acceptor site probably null
R3619:Plxna1 UTSW 6 89,357,453 (GRCm38) missense probably damaging 0.97
R3766:Plxna1 UTSW 6 89,334,775 (GRCm38) unclassified probably benign
R3847:Plxna1 UTSW 6 89,356,519 (GRCm38) missense probably damaging 1.00
R3849:Plxna1 UTSW 6 89,356,519 (GRCm38) missense probably damaging 1.00
R3872:Plxna1 UTSW 6 89,332,692 (GRCm38) nonsense probably null
R4555:Plxna1 UTSW 6 89,323,328 (GRCm38) missense probably damaging 0.99
R4709:Plxna1 UTSW 6 89,334,751 (GRCm38) missense possibly damaging 0.72
R4726:Plxna1 UTSW 6 89,322,816 (GRCm38) missense probably damaging 1.00
R5053:Plxna1 UTSW 6 89,322,460 (GRCm38) missense probably damaging 1.00
R5221:Plxna1 UTSW 6 89,321,016 (GRCm38) missense probably damaging 1.00
R5449:Plxna1 UTSW 6 89,323,608 (GRCm38) missense probably damaging 1.00
R5480:Plxna1 UTSW 6 89,324,634 (GRCm38) missense probably damaging 1.00
R5575:Plxna1 UTSW 6 89,324,541 (GRCm38) missense possibly damaging 0.83
R5743:Plxna1 UTSW 6 89,356,529 (GRCm38) missense probably damaging 1.00
R5744:Plxna1 UTSW 6 89,334,682 (GRCm38) missense possibly damaging 0.67
R5754:Plxna1 UTSW 6 89,333,105 (GRCm38) missense possibly damaging 0.96
R5868:Plxna1 UTSW 6 89,322,722 (GRCm38) splice site probably benign
R5988:Plxna1 UTSW 6 89,357,540 (GRCm38) nonsense probably null
R6190:Plxna1 UTSW 6 89,356,604 (GRCm38) nonsense probably null
R6425:Plxna1 UTSW 6 89,334,665 (GRCm38) missense probably benign 0.00
R6561:Plxna1 UTSW 6 89,356,978 (GRCm38) missense probably damaging 1.00
R6623:Plxna1 UTSW 6 89,322,771 (GRCm38) missense probably damaging 1.00
R6638:Plxna1 UTSW 6 89,324,400 (GRCm38) missense probably damaging 0.97
R6701:Plxna1 UTSW 6 89,319,448 (GRCm38) missense probably damaging 0.99
R6825:Plxna1 UTSW 6 89,320,615 (GRCm38) missense probably benign 0.01
R6911:Plxna1 UTSW 6 89,320,974 (GRCm38) missense probably damaging 1.00
R7073:Plxna1 UTSW 6 89,357,329 (GRCm38) missense probably damaging 1.00
R7177:Plxna1 UTSW 6 89,323,329 (GRCm38) missense possibly damaging 0.50
R7235:Plxna1 UTSW 6 89,340,591 (GRCm38) missense probably damaging 0.97
R7419:Plxna1 UTSW 6 89,357,602 (GRCm38) missense unknown
R7511:Plxna1 UTSW 6 89,341,907 (GRCm38) missense possibly damaging 0.71
R7543:Plxna1 UTSW 6 89,322,855 (GRCm38) missense probably damaging 1.00
R7665:Plxna1 UTSW 6 89,324,538 (GRCm38) critical splice donor site probably null
R7678:Plxna1 UTSW 6 89,331,900 (GRCm38) missense probably damaging 0.99
R7748:Plxna1 UTSW 6 89,337,353 (GRCm38) critical splice acceptor site probably null
R7748:Plxna1 UTSW 6 89,337,352 (GRCm38) critical splice acceptor site probably null
R7877:Plxna1 UTSW 6 89,323,259 (GRCm38) missense probably damaging 0.99
R8025:Plxna1 UTSW 6 89,331,272 (GRCm38) missense probably damaging 1.00
R8171:Plxna1 UTSW 6 89,357,120 (GRCm38) missense probably benign 0.20
R8277:Plxna1 UTSW 6 89,357,180 (GRCm38) missense probably damaging 1.00
R8782:Plxna1 UTSW 6 89,323,238 (GRCm38) missense probably damaging 1.00
R8867:Plxna1 UTSW 6 89,333,097 (GRCm38) missense probably benign 0.00
R9245:Plxna1 UTSW 6 89,337,338 (GRCm38) missense probably damaging 1.00
R9253:Plxna1 UTSW 6 89,357,540 (GRCm38) nonsense probably null
R9269:Plxna1 UTSW 6 89,329,559 (GRCm38) missense probably null 1.00
R9273:Plxna1 UTSW 6 89,319,382 (GRCm38) missense possibly damaging 0.77
R9281:Plxna1 UTSW 6 89,323,331 (GRCm38) missense probably damaging 1.00
R9368:Plxna1 UTSW 6 89,337,156 (GRCm38) missense probably benign
R9440:Plxna1 UTSW 6 89,341,930 (GRCm38) missense probably benign 0.00
R9526:Plxna1 UTSW 6 89,342,651 (GRCm38) missense probably benign
R9601:Plxna1 UTSW 6 89,331,271 (GRCm38) missense probably damaging 1.00
R9714:Plxna1 UTSW 6 89,319,458 (GRCm38) missense probably damaging 0.99
R9782:Plxna1 UTSW 6 89,356,835 (GRCm38) missense probably benign 0.01
S24628:Plxna1 UTSW 6 89,357,336 (GRCm38) missense probably benign 0.12
V8831:Plxna1 UTSW 6 89,357,137 (GRCm38) missense probably damaging 0.99
Z1176:Plxna1 UTSW 6 89,321,052 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGAGCTTGCTCAAGATGTC -3'
(R):5'- TCATGCAAGAAGAGACTGTGTC -3'

Sequencing Primer
(F):5'- GAGAGCTTGCTCAAGATGTCTATTC -3'
(R):5'- ACTGTGTCTCTTGTATGTCTAGGCC -3'
Posted On 2015-11-11