Incidental Mutation 'R4739:Dnah3'
ID 359525
Institutional Source Beutler Lab
Gene Symbol Dnah3
Ensembl Gene ENSMUSG00000052273
Gene Name dynein, axonemal, heavy chain 3
Synonyms Dnahc3
MMRRC Submission 042025-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R4739 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 119521894-119694503 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119677169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 444 (D444G)
Ref Sequence ENSEMBL: ENSMUSP00000042857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000046993
AA Change: D444G

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: D444G

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
Pfam:DHC_N2 826 1235 3.3e-144 PFAM
AAA 1388 1527 1.59e-1 SMART
low complexity region 1594 1606 N/A INTRINSIC
Blast:AAA 1669 1897 9e-84 BLAST
AAA 2033 2180 1.33e-3 SMART
Pfam:AAA_8 2362 2632 1.5e-63 PFAM
Pfam:MT 2644 2994 7.4e-52 PFAM
Pfam:AAA_9 3015 3240 3.5e-92 PFAM
low complexity region 3338 3349 N/A INTRINSIC
Pfam:Dynein_heavy 3376 4079 4.4e-285 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209154
AA Change: D445G

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000213149
Meta Mutation Damage Score 0.0928 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,796,904 (GRCm39) noncoding transcript Het
2300002M23Rik A G 17: 35,878,403 (GRCm39) probably benign Het
Aadat T C 8: 60,993,140 (GRCm39) V360A probably benign Het
Abcc5 T A 16: 20,218,376 (GRCm39) D283V probably damaging Het
Abraxas1 T A 5: 100,959,886 (GRCm39) K155N probably damaging Het
Acot3 T C 12: 84,105,364 (GRCm39) I277T probably benign Het
Ankrd45 G A 1: 160,982,960 (GRCm39) C157Y probably damaging Het
Apol10a C T 15: 77,372,841 (GRCm39) T159I possibly damaging Het
Arhgef11 G A 3: 87,605,306 (GRCm39) V214M possibly damaging Het
Ash1l A C 3: 88,890,152 (GRCm39) N677T probably benign Het
Atg13 A G 2: 91,515,040 (GRCm39) S254P probably damaging Het
Atg16l2 A G 7: 100,946,385 (GRCm39) L129P probably damaging Het
Avl9 T A 6: 56,703,294 (GRCm39) V120D probably damaging Het
Castor1 A G 11: 4,169,004 (GRCm39) E57G possibly damaging Het
Cc2d1b T C 4: 108,485,239 (GRCm39) V527A probably benign Het
Ccnl1 A G 3: 65,854,092 (GRCm39) probably benign Het
Cenpl T A 1: 160,910,837 (GRCm39) D261E probably damaging Het
Cep192 T G 18: 67,984,803 (GRCm39) I1604M probably benign Het
Cep95 A G 11: 106,706,560 (GRCm39) I573V probably benign Het
Cfap100 A G 6: 90,389,825 (GRCm39) probably null Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cmc1 T A 9: 117,904,245 (GRCm39) M49L probably benign Het
Cyfip2 G T 11: 46,170,820 (GRCm39) N176K probably damaging Het
Cyp2w1 T C 5: 139,342,430 (GRCm39) F408L probably damaging Het
D630045J12Rik G A 6: 38,172,971 (GRCm39) S399F possibly damaging Het
Dcbld2 T A 16: 58,281,339 (GRCm39) L528Q probably damaging Het
Dip2b T C 15: 100,105,658 (GRCm39) V1138A probably damaging Het
Dip2c T A 13: 9,583,375 (GRCm39) L119Q probably damaging Het
Dsg1c A T 18: 20,408,246 (GRCm39) N432Y possibly damaging Het
Dst T A 1: 34,230,228 (GRCm39) I2785N probably benign Het
Dynap A T 18: 70,374,296 (GRCm39) Y77N possibly damaging Het
Eif4g3 T C 4: 137,910,510 (GRCm39) L1330P possibly damaging Het
Eif4g3 T A 4: 137,925,408 (GRCm39) S1584T probably benign Het
Enpp1 A T 10: 24,555,146 (GRCm39) C67S probably null Het
Enpp5 C T 17: 44,392,027 (GRCm39) T152I probably damaging Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Erc2 T G 14: 27,498,838 (GRCm39) L238R probably damaging Het
Eya3 T A 4: 132,448,698 (GRCm39) probably benign Het
Farp1 T C 14: 121,476,199 (GRCm39) F339L probably damaging Het
Fsip2 A C 2: 82,805,697 (GRCm39) D672A possibly damaging Het
Gap43 G T 16: 42,112,581 (GRCm39) P60Q probably benign Het
Gpr37l1 T A 1: 135,094,783 (GRCm39) I154F probably damaging Het
Greb1 A G 12: 16,746,329 (GRCm39) S1314P probably damaging Het
Hectd4 A T 5: 121,486,505 (GRCm39) M3167L probably benign Het
Hps3 C T 3: 20,084,574 (GRCm39) probably null Het
Hps5 A G 7: 46,436,013 (GRCm39) C178R probably benign Het
Hspg2 T A 4: 137,297,384 (GRCm39) probably benign Het
Impdh2-ps A G 8: 100,757,839 (GRCm39) noncoding transcript Het
Josd2 T A 7: 44,120,678 (GRCm39) N138K probably damaging Het
Mtmr6 T G 14: 60,529,546 (GRCm39) M315R probably damaging Het
Mtrf1 G A 14: 79,650,520 (GRCm39) V323M probably damaging Het
Myo16 G T 8: 10,423,527 (GRCm39) G288W probably damaging Het
Myo18a T C 11: 77,714,149 (GRCm39) Y748H probably damaging Het
Nek1 A T 8: 61,551,545 (GRCm39) N853I probably benign Het
Npnt T G 3: 132,610,452 (GRCm39) T272P possibly damaging Het
Obi1 C T 14: 104,747,819 (GRCm39) D43N probably damaging Het
Or2ag1b C A 7: 106,288,351 (GRCm39) E196* probably null Het
Or2b6 T A 13: 21,823,340 (GRCm39) M118L possibly damaging Het
Or2y17 G A 11: 49,232,148 (GRCm39) G263D probably benign Het
Or51e1 T A 7: 102,359,378 (GRCm39) I304N probably damaging Het
Or52n2c G A 7: 104,574,017 (GRCm39) T318I possibly damaging Het
Or5a1 A G 19: 12,097,234 (GRCm39) Y269H possibly damaging Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Pappa2 T G 1: 158,784,572 (GRCm39) D146A probably damaging Het
Pcsk9 C T 4: 106,304,353 (GRCm39) G496R probably damaging Het
Pes1 A G 11: 3,914,058 (GRCm39) K8E probably damaging Het
Phlpp2 G A 8: 110,667,052 (GRCm39) G1194S probably damaging Het
Pkn1 A C 8: 84,398,378 (GRCm39) V763G probably damaging Het
Pkp2 C A 16: 16,048,588 (GRCm39) A331E probably damaging Het
Plb1 T A 5: 32,507,023 (GRCm39) probably null Het
Plxna1 A T 6: 89,309,657 (GRCm39) probably null Het
Polq C T 16: 36,862,109 (GRCm39) T264M probably damaging Het
Prkag3 T C 1: 74,779,864 (GRCm39) *490W probably null Het
Prl2c1 T C 13: 28,041,661 (GRCm39) C228R probably damaging Het
Pus7l T C 15: 94,438,591 (GRCm39) S85G probably benign Het
Rfc3 A C 5: 151,568,241 (GRCm39) probably benign Het
Riox2 A G 16: 59,309,732 (GRCm39) N362S probably benign Het
Scaper A T 9: 55,650,932 (GRCm39) D904E probably damaging Het
Scn11a T C 9: 119,583,627 (GRCm39) M1663V probably benign Het
Slc13a3 A T 2: 165,272,209 (GRCm39) I278N possibly damaging Het
Slc22a7 T C 17: 46,745,923 (GRCm39) E278G probably damaging Het
Snrnp48 T A 13: 38,393,893 (GRCm39) M66K probably damaging Het
Styk1 T G 6: 131,277,429 (GRCm39) E404A probably damaging Het
Synj1 T A 16: 90,752,307 (GRCm39) H1016L probably benign Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tjp2 T C 19: 24,097,475 (GRCm39) probably null Het
Tmem87a A G 2: 120,190,518 (GRCm39) probably null Het
Trappc9 T G 15: 72,808,909 (GRCm39) Y718S probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Ugt2a3 C T 5: 87,475,054 (GRCm39) G397R probably damaging Het
Wdr33 T A 18: 32,019,139 (GRCm39) M454K probably benign Het
Wdtc1 G T 4: 133,029,110 (GRCm39) N325K possibly damaging Het
Whrn T C 4: 63,336,402 (GRCm39) H720R probably damaging Het
Xirp2 A T 2: 67,349,609 (GRCm39) D3268V probably damaging Het
Zc3h7a A T 16: 10,959,573 (GRCm39) H793Q probably damaging Het
Zfp518b C T 5: 38,831,841 (GRCm39) A55T possibly damaging Het
Zmynd8 G A 2: 165,647,249 (GRCm39) T901M probably damaging Het
Other mutations in Dnah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Dnah3 APN 7 119,538,128 (GRCm39) missense possibly damaging 0.88
IGL01095:Dnah3 APN 7 119,550,820 (GRCm39) missense probably benign 0.02
IGL01329:Dnah3 APN 7 119,622,164 (GRCm39) missense probably damaging 1.00
IGL01380:Dnah3 APN 7 119,525,787 (GRCm39) missense probably damaging 1.00
IGL01410:Dnah3 APN 7 119,566,943 (GRCm39) missense possibly damaging 0.91
IGL01487:Dnah3 APN 7 119,564,753 (GRCm39) nonsense probably null
IGL01843:Dnah3 APN 7 119,542,798 (GRCm39) missense probably benign 0.12
IGL01929:Dnah3 APN 7 119,550,874 (GRCm39) nonsense probably null
IGL01994:Dnah3 APN 7 119,550,437 (GRCm39) missense possibly damaging 0.58
IGL02115:Dnah3 APN 7 119,628,277 (GRCm39) missense probably damaging 1.00
IGL02273:Dnah3 APN 7 119,550,494 (GRCm39) missense probably damaging 1.00
IGL02299:Dnah3 APN 7 119,566,802 (GRCm39) missense probably benign 0.39
IGL02421:Dnah3 APN 7 119,550,215 (GRCm39) missense possibly damaging 0.87
IGL02514:Dnah3 APN 7 119,565,470 (GRCm39) missense probably damaging 1.00
IGL02596:Dnah3 APN 7 119,538,137 (GRCm39) missense probably benign 0.19
IGL02716:Dnah3 APN 7 119,536,246 (GRCm39) missense probably damaging 0.97
IGL02738:Dnah3 APN 7 119,564,720 (GRCm39) missense probably benign
IGL03404:Dnah3 APN 7 119,538,200 (GRCm39) missense probably damaging 1.00
R0964_Dnah3_480 UTSW 7 119,551,962 (GRCm39) splice site probably benign
R1778_Dnah3_238 UTSW 7 119,677,625 (GRCm39) missense probably damaging 1.00
R4658_Dnah3_599 UTSW 7 119,549,874 (GRCm39) missense probably damaging 1.00
BB004:Dnah3 UTSW 7 119,550,494 (GRCm39) missense probably damaging 0.97
BB014:Dnah3 UTSW 7 119,550,494 (GRCm39) missense probably damaging 0.97
R0011:Dnah3 UTSW 7 119,618,924 (GRCm39) missense probably damaging 1.00
R0195:Dnah3 UTSW 7 119,676,998 (GRCm39) critical splice donor site probably null
R0241:Dnah3 UTSW 7 119,521,953 (GRCm39) missense probably damaging 1.00
R0241:Dnah3 UTSW 7 119,521,953 (GRCm39) missense probably damaging 1.00
R0312:Dnah3 UTSW 7 119,644,882 (GRCm39) missense probably damaging 1.00
R0316:Dnah3 UTSW 7 119,564,882 (GRCm39) missense possibly damaging 0.94
R0370:Dnah3 UTSW 7 119,685,943 (GRCm39) missense possibly damaging 0.91
R0426:Dnah3 UTSW 7 119,542,795 (GRCm39) missense probably benign 0.11
R0525:Dnah3 UTSW 7 119,527,977 (GRCm39) missense probably damaging 1.00
R0625:Dnah3 UTSW 7 119,671,110 (GRCm39) missense possibly damaging 0.68
R0627:Dnah3 UTSW 7 119,620,138 (GRCm39) missense probably damaging 1.00
R0632:Dnah3 UTSW 7 119,567,128 (GRCm39) missense probably benign 0.11
R0928:Dnah3 UTSW 7 119,629,274 (GRCm39) missense probably damaging 1.00
R0964:Dnah3 UTSW 7 119,551,962 (GRCm39) splice site probably benign
R0972:Dnah3 UTSW 7 119,634,563 (GRCm39) splice site probably null
R1066:Dnah3 UTSW 7 119,660,232 (GRCm39) missense probably damaging 1.00
R1082:Dnah3 UTSW 7 119,677,668 (GRCm39) missense probably damaging 1.00
R1127:Dnah3 UTSW 7 119,522,253 (GRCm39) missense probably damaging 1.00
R1132:Dnah3 UTSW 7 119,538,227 (GRCm39) missense possibly damaging 0.50
R1222:Dnah3 UTSW 7 119,689,899 (GRCm39) missense probably benign 0.28
R1420:Dnah3 UTSW 7 119,551,202 (GRCm39) missense probably damaging 0.99
R1456:Dnah3 UTSW 7 119,646,853 (GRCm39) missense probably damaging 1.00
R1472:Dnah3 UTSW 7 119,670,181 (GRCm39) missense probably benign 0.12
R1617:Dnah3 UTSW 7 119,689,169 (GRCm39) missense probably benign 0.01
R1624:Dnah3 UTSW 7 119,618,918 (GRCm39) missense probably damaging 0.99
R1654:Dnah3 UTSW 7 119,525,672 (GRCm39) missense probably damaging 1.00
R1673:Dnah3 UTSW 7 119,570,402 (GRCm39) nonsense probably null
R1677:Dnah3 UTSW 7 119,527,963 (GRCm39) missense probably damaging 1.00
R1687:Dnah3 UTSW 7 119,645,009 (GRCm39) splice site probably null
R1711:Dnah3 UTSW 7 119,677,794 (GRCm39) missense probably damaging 1.00
R1738:Dnah3 UTSW 7 119,634,582 (GRCm39) missense probably damaging 1.00
R1778:Dnah3 UTSW 7 119,677,625 (GRCm39) missense probably damaging 1.00
R1866:Dnah3 UTSW 7 119,528,079 (GRCm39) splice site probably null
R1883:Dnah3 UTSW 7 119,677,142 (GRCm39) missense probably benign 0.06
R1894:Dnah3 UTSW 7 119,685,557 (GRCm39) missense probably benign 0.05
R1929:Dnah3 UTSW 7 119,574,352 (GRCm39) missense probably benign 0.10
R1988:Dnah3 UTSW 7 119,567,182 (GRCm39) missense probably damaging 0.99
R1988:Dnah3 UTSW 7 119,566,793 (GRCm39) missense possibly damaging 0.92
R2010:Dnah3 UTSW 7 119,694,400 (GRCm39) start codon destroyed probably benign 0.00
R2022:Dnah3 UTSW 7 119,550,465 (GRCm39) missense probably damaging 1.00
R2026:Dnah3 UTSW 7 119,638,629 (GRCm39) missense probably damaging 1.00
R2063:Dnah3 UTSW 7 119,551,132 (GRCm39) missense probably damaging 0.96
R2131:Dnah3 UTSW 7 119,566,982 (GRCm39) missense possibly damaging 0.93
R2152:Dnah3 UTSW 7 119,551,236 (GRCm39) missense probably benign 0.02
R2199:Dnah3 UTSW 7 119,550,792 (GRCm39) missense possibly damaging 0.89
R2271:Dnah3 UTSW 7 119,574,352 (GRCm39) missense probably benign 0.10
R2350:Dnah3 UTSW 7 119,645,011 (GRCm39) splice site probably null
R2567:Dnah3 UTSW 7 119,551,920 (GRCm39) missense possibly damaging 0.83
R2848:Dnah3 UTSW 7 119,567,161 (GRCm39) missense probably benign 0.01
R2902:Dnah3 UTSW 7 119,550,722 (GRCm39) missense possibly damaging 0.61
R2926:Dnah3 UTSW 7 119,550,338 (GRCm39) missense probably damaging 1.00
R2944:Dnah3 UTSW 7 119,550,333 (GRCm39) missense probably damaging 1.00
R3022:Dnah3 UTSW 7 119,677,704 (GRCm39) missense possibly damaging 0.93
R3401:Dnah3 UTSW 7 119,566,879 (GRCm39) missense probably benign 0.00
R3402:Dnah3 UTSW 7 119,566,879 (GRCm39) missense probably benign 0.00
R3403:Dnah3 UTSW 7 119,566,879 (GRCm39) missense probably benign 0.00
R3919:Dnah3 UTSW 7 119,550,303 (GRCm39) missense probably damaging 1.00
R3972:Dnah3 UTSW 7 119,685,943 (GRCm39) missense probably damaging 0.99
R4162:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4184:Dnah3 UTSW 7 119,682,516 (GRCm39) missense probably damaging 1.00
R4198:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4199:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4200:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4239:Dnah3 UTSW 7 119,628,248 (GRCm39) nonsense probably null
R4478:Dnah3 UTSW 7 119,671,086 (GRCm39) missense probably benign 0.00
R4579:Dnah3 UTSW 7 119,608,554 (GRCm39) missense probably damaging 1.00
R4600:Dnah3 UTSW 7 119,689,169 (GRCm39) missense probably benign
R4649:Dnah3 UTSW 7 119,646,921 (GRCm39) missense probably damaging 1.00
R4658:Dnah3 UTSW 7 119,549,874 (GRCm39) missense probably damaging 1.00
R4728:Dnah3 UTSW 7 119,658,589 (GRCm39) missense probably damaging 0.99
R4758:Dnah3 UTSW 7 119,678,629 (GRCm39) missense probably benign 0.00
R4785:Dnah3 UTSW 7 119,567,047 (GRCm39) missense probably benign 0.29
R4789:Dnah3 UTSW 7 119,610,295 (GRCm39) missense probably damaging 1.00
R4930:Dnah3 UTSW 7 119,550,904 (GRCm39) nonsense probably null
R4935:Dnah3 UTSW 7 119,615,700 (GRCm39) nonsense probably null
R4946:Dnah3 UTSW 7 119,530,783 (GRCm39) missense probably damaging 1.00
R4981:Dnah3 UTSW 7 119,555,424 (GRCm39) missense probably benign 0.03
R4984:Dnah3 UTSW 7 119,528,002 (GRCm39) missense probably benign 0.04
R5025:Dnah3 UTSW 7 119,671,128 (GRCm39) missense probably benign 0.02
R5046:Dnah3 UTSW 7 119,550,803 (GRCm39) missense probably damaging 1.00
R5056:Dnah3 UTSW 7 119,620,169 (GRCm39) missense probably damaging 1.00
R5068:Dnah3 UTSW 7 119,632,013 (GRCm39) missense probably benign
R5069:Dnah3 UTSW 7 119,632,013 (GRCm39) missense probably benign
R5154:Dnah3 UTSW 7 119,551,642 (GRCm39) missense probably damaging 1.00
R5208:Dnah3 UTSW 7 119,631,861 (GRCm39) missense probably damaging 1.00
R5323:Dnah3 UTSW 7 119,620,234 (GRCm39) missense probably damaging 1.00
R5330:Dnah3 UTSW 7 119,542,871 (GRCm39) missense probably benign 0.00
R5385:Dnah3 UTSW 7 119,524,126 (GRCm39) missense probably damaging 1.00
R5391:Dnah3 UTSW 7 119,689,299 (GRCm39) missense probably benign 0.02
R5564:Dnah3 UTSW 7 119,570,689 (GRCm39) critical splice donor site probably null
R5594:Dnah3 UTSW 7 119,570,844 (GRCm39) missense possibly damaging 0.89
R5610:Dnah3 UTSW 7 119,538,288 (GRCm39) splice site probably null
R5673:Dnah3 UTSW 7 119,550,812 (GRCm39) missense possibly damaging 0.91
R5678:Dnah3 UTSW 7 119,677,074 (GRCm39) missense probably benign 0.00
R5737:Dnah3 UTSW 7 119,658,421 (GRCm39) missense probably benign 0.03
R5766:Dnah3 UTSW 7 119,577,445 (GRCm39) missense probably damaging 1.00
R5769:Dnah3 UTSW 7 119,689,175 (GRCm39) nonsense probably null
R5789:Dnah3 UTSW 7 119,542,822 (GRCm39) missense possibly damaging 0.70
R5791:Dnah3 UTSW 7 119,530,696 (GRCm39) missense probably benign 0.00
R5841:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5843:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5844:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5846:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5851:Dnah3 UTSW 7 119,638,585 (GRCm39) missense possibly damaging 0.51
R5853:Dnah3 UTSW 7 119,538,056 (GRCm39) missense probably damaging 1.00
R5857:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5865:Dnah3 UTSW 7 119,574,331 (GRCm39) missense probably benign 0.00
R5885:Dnah3 UTSW 7 119,668,927 (GRCm39) missense probably benign 0.10
R5898:Dnah3 UTSW 7 119,677,724 (GRCm39) missense probably benign 0.37
R5917:Dnah3 UTSW 7 119,615,749 (GRCm39) missense probably damaging 1.00
R5964:Dnah3 UTSW 7 119,522,103 (GRCm39) missense probably benign 0.00
R5990:Dnah3 UTSW 7 119,672,764 (GRCm39) missense probably benign
R6004:Dnah3 UTSW 7 119,685,520 (GRCm39) missense probably benign 0.10
R6033:Dnah3 UTSW 7 119,670,870 (GRCm39) missense probably benign 0.00
R6033:Dnah3 UTSW 7 119,670,870 (GRCm39) missense probably benign 0.00
R6045:Dnah3 UTSW 7 119,566,745 (GRCm39) missense probably damaging 0.99
R6056:Dnah3 UTSW 7 119,629,254 (GRCm39) missense probably damaging 1.00
R6133:Dnah3 UTSW 7 119,685,469 (GRCm39) missense probably benign 0.10
R6229:Dnah3 UTSW 7 119,564,711 (GRCm39) missense probably benign 0.11
R6237:Dnah3 UTSW 7 119,608,607 (GRCm39) missense probably damaging 1.00
R6333:Dnah3 UTSW 7 119,653,856 (GRCm39) missense probably damaging 1.00
R6408:Dnah3 UTSW 7 119,522,191 (GRCm39) splice site probably null
R6447:Dnah3 UTSW 7 119,522,277 (GRCm39) missense probably benign 0.12
R6606:Dnah3 UTSW 7 119,660,179 (GRCm39) missense probably benign 0.02
R6666:Dnah3 UTSW 7 119,670,172 (GRCm39) missense probably benign 0.16
R6733:Dnah3 UTSW 7 119,522,197 (GRCm39) missense probably benign 0.22
R6815:Dnah3 UTSW 7 119,570,950 (GRCm39) missense probably benign
R6882:Dnah3 UTSW 7 119,570,407 (GRCm39) missense possibly damaging 0.95
R6934:Dnah3 UTSW 7 119,653,824 (GRCm39) critical splice donor site probably null
R6966:Dnah3 UTSW 7 119,631,977 (GRCm39) missense probably damaging 1.00
R7025:Dnah3 UTSW 7 119,629,233 (GRCm39) missense possibly damaging 0.90
R7207:Dnah3 UTSW 7 119,570,312 (GRCm39) missense probably damaging 1.00
R7214:Dnah3 UTSW 7 119,521,965 (GRCm39) missense probably damaging 1.00
R7222:Dnah3 UTSW 7 119,670,746 (GRCm39) missense probably benign 0.00
R7235:Dnah3 UTSW 7 119,631,893 (GRCm39) missense probably damaging 1.00
R7241:Dnah3 UTSW 7 119,542,856 (GRCm39) missense probably benign 0.03
R7313:Dnah3 UTSW 7 119,580,567 (GRCm39) missense probably benign 0.39
R7342:Dnah3 UTSW 7 119,629,208 (GRCm39) missense probably damaging 1.00
R7368:Dnah3 UTSW 7 119,628,239 (GRCm39) missense probably benign
R7375:Dnah3 UTSW 7 119,550,900 (GRCm39) missense probably damaging 1.00
R7395:Dnah3 UTSW 7 119,660,183 (GRCm39) missense probably benign 0.00
R7395:Dnah3 UTSW 7 119,565,474 (GRCm39) missense
R7431:Dnah3 UTSW 7 119,650,967 (GRCm39) missense probably damaging 1.00
R7499:Dnah3 UTSW 7 119,660,135 (GRCm39) missense probably damaging 0.99
R7515:Dnah3 UTSW 7 119,672,815 (GRCm39) missense probably benign 0.21
R7564:Dnah3 UTSW 7 119,570,817 (GRCm39) missense probably benign
R7618:Dnah3 UTSW 7 119,577,601 (GRCm39) missense probably damaging 0.97
R7697:Dnah3 UTSW 7 119,566,657 (GRCm39) missense
R7728:Dnah3 UTSW 7 119,538,051 (GRCm39) missense probably damaging 1.00
R7757:Dnah3 UTSW 7 119,570,438 (GRCm39) splice site probably null
R7757:Dnah3 UTSW 7 119,670,793 (GRCm39) missense probably benign
R7774:Dnah3 UTSW 7 119,550,975 (GRCm39) nonsense probably null
R7804:Dnah3 UTSW 7 119,610,235 (GRCm39) missense probably damaging 1.00
R7804:Dnah3 UTSW 7 119,551,841 (GRCm39) missense probably damaging 1.00
R7857:Dnah3 UTSW 7 119,550,927 (GRCm39) missense probably damaging 1.00
R7871:Dnah3 UTSW 7 119,566,775 (GRCm39) missense
R7903:Dnah3 UTSW 7 119,641,351 (GRCm39) missense probably damaging 1.00
R7927:Dnah3 UTSW 7 119,550,494 (GRCm39) missense probably damaging 0.97
R7989:Dnah3 UTSW 7 119,677,012 (GRCm39) missense probably benign
R8142:Dnah3 UTSW 7 119,660,189 (GRCm39) missense probably benign 0.00
R8164:Dnah3 UTSW 7 119,566,837 (GRCm39) missense probably damaging 1.00
R8237:Dnah3 UTSW 7 119,525,636 (GRCm39) missense probably benign 0.01
R8313:Dnah3 UTSW 7 119,550,375 (GRCm39) missense probably benign 0.38
R8338:Dnah3 UTSW 7 119,671,104 (GRCm39) missense probably benign 0.01
R8355:Dnah3 UTSW 7 119,551,431 (GRCm39) missense probably damaging 1.00
R8408:Dnah3 UTSW 7 119,551,728 (GRCm39) missense probably damaging 1.00
R8411:Dnah3 UTSW 7 119,610,253 (GRCm39) missense probably damaging 1.00
R8455:Dnah3 UTSW 7 119,551,431 (GRCm39) missense probably damaging 1.00
R8483:Dnah3 UTSW 7 119,536,253 (GRCm39) missense probably benign 0.00
R8531:Dnah3 UTSW 7 119,550,591 (GRCm39) missense probably damaging 1.00
R8885:Dnah3 UTSW 7 119,561,375 (GRCm39) missense
R8912:Dnah3 UTSW 7 119,689,869 (GRCm39) missense probably benign 0.06
R8966:Dnah3 UTSW 7 119,549,881 (GRCm39) nonsense probably null
R8982:Dnah3 UTSW 7 119,536,294 (GRCm39) missense probably damaging 1.00
R9043:Dnah3 UTSW 7 119,551,272 (GRCm39) missense probably benign
R9053:Dnah3 UTSW 7 119,618,987 (GRCm39) missense possibly damaging 0.67
R9059:Dnah3 UTSW 7 119,684,368 (GRCm39) missense probably benign 0.01
R9182:Dnah3 UTSW 7 119,684,351 (GRCm39) missense probably damaging 0.98
R9365:Dnah3 UTSW 7 119,566,859 (GRCm39) missense
R9383:Dnah3 UTSW 7 119,646,819 (GRCm39) missense probably benign 0.23
R9430:Dnah3 UTSW 7 119,628,205 (GRCm39) missense probably damaging 1.00
R9449:Dnah3 UTSW 7 119,551,473 (GRCm39) missense probably benign 0.12
R9462:Dnah3 UTSW 7 119,551,523 (GRCm39) missense probably benign 0.05
R9505:Dnah3 UTSW 7 119,644,912 (GRCm39) missense probably damaging 1.00
R9559:Dnah3 UTSW 7 119,650,951 (GRCm39) missense probably benign 0.07
R9562:Dnah3 UTSW 7 119,610,114 (GRCm39) missense probably benign 0.05
R9565:Dnah3 UTSW 7 119,610,114 (GRCm39) missense probably benign 0.05
R9609:Dnah3 UTSW 7 119,670,236 (GRCm39) missense probably damaging 0.98
R9622:Dnah3 UTSW 7 119,561,356 (GRCm39) missense
R9633:Dnah3 UTSW 7 119,550,216 (GRCm39) missense probably benign
R9654:Dnah3 UTSW 7 119,641,396 (GRCm39) nonsense probably null
R9665:Dnah3 UTSW 7 119,644,981 (GRCm39) missense probably benign 0.01
R9681:Dnah3 UTSW 7 119,677,611 (GRCm39) missense probably benign 0.04
R9717:Dnah3 UTSW 7 119,574,299 (GRCm39) missense probably damaging 1.00
Z1088:Dnah3 UTSW 7 119,610,096 (GRCm39) missense probably null 1.00
Z1088:Dnah3 UTSW 7 119,685,520 (GRCm39) missense probably benign 0.00
Z1176:Dnah3 UTSW 7 119,567,026 (GRCm39) missense
Z1177:Dnah3 UTSW 7 119,607,085 (GRCm39) missense probably benign
Z1177:Dnah3 UTSW 7 119,567,124 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTTGCAACCAGCCACTTG -3'
(R):5'- GGAGACATGAATTACAATAAGCTATCC -3'

Sequencing Primer
(F):5'- GGCAAAAACTATACCTTGGGGATCC -3'
(R):5'- TATCCCATGGAAAGGCCTTG -3'
Posted On 2015-11-11