Incidental Mutation 'R4739:Or2b6'
ID 359543
Institutional Source Beutler Lab
Gene Symbol Or2b6
Ensembl Gene ENSMUSG00000036658
Gene Name olfactory receptor family 2 subfamily B member 6
Synonyms GA_x6K02T2QHY8-11597382-11598323, MOR256-11, Olfr11
MMRRC Submission 042025-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.350) question?
Stock # R4739 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 21822750-21823691 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21823340 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 118 (M118L)
Ref Sequence ENSEMBL: ENSMUSP00000146091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043081] [ENSMUST00000205631]
AlphaFold Q60890
Predicted Effect possibly damaging
Transcript: ENSMUST00000043081
AA Change: M118L

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043099
Gene: ENSMUSG00000036658
AA Change: M118L

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 4.9e-51 PFAM
Pfam:7tm_1 41 290 7.3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205631
AA Change: M118L

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1696 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,796,904 (GRCm39) noncoding transcript Het
2300002M23Rik A G 17: 35,878,403 (GRCm39) probably benign Het
Aadat T C 8: 60,993,140 (GRCm39) V360A probably benign Het
Abcc5 T A 16: 20,218,376 (GRCm39) D283V probably damaging Het
Abraxas1 T A 5: 100,959,886 (GRCm39) K155N probably damaging Het
Acot3 T C 12: 84,105,364 (GRCm39) I277T probably benign Het
Ankrd45 G A 1: 160,982,960 (GRCm39) C157Y probably damaging Het
Apol10a C T 15: 77,372,841 (GRCm39) T159I possibly damaging Het
Arhgef11 G A 3: 87,605,306 (GRCm39) V214M possibly damaging Het
Ash1l A C 3: 88,890,152 (GRCm39) N677T probably benign Het
Atg13 A G 2: 91,515,040 (GRCm39) S254P probably damaging Het
Atg16l2 A G 7: 100,946,385 (GRCm39) L129P probably damaging Het
Avl9 T A 6: 56,703,294 (GRCm39) V120D probably damaging Het
Castor1 A G 11: 4,169,004 (GRCm39) E57G possibly damaging Het
Cc2d1b T C 4: 108,485,239 (GRCm39) V527A probably benign Het
Ccnl1 A G 3: 65,854,092 (GRCm39) probably benign Het
Cenpl T A 1: 160,910,837 (GRCm39) D261E probably damaging Het
Cep192 T G 18: 67,984,803 (GRCm39) I1604M probably benign Het
Cep95 A G 11: 106,706,560 (GRCm39) I573V probably benign Het
Cfap100 A G 6: 90,389,825 (GRCm39) probably null Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cmc1 T A 9: 117,904,245 (GRCm39) M49L probably benign Het
Cyfip2 G T 11: 46,170,820 (GRCm39) N176K probably damaging Het
Cyp2w1 T C 5: 139,342,430 (GRCm39) F408L probably damaging Het
D630045J12Rik G A 6: 38,172,971 (GRCm39) S399F possibly damaging Het
Dcbld2 T A 16: 58,281,339 (GRCm39) L528Q probably damaging Het
Dip2b T C 15: 100,105,658 (GRCm39) V1138A probably damaging Het
Dip2c T A 13: 9,583,375 (GRCm39) L119Q probably damaging Het
Dnah3 T C 7: 119,677,169 (GRCm39) D444G possibly damaging Het
Dsg1c A T 18: 20,408,246 (GRCm39) N432Y possibly damaging Het
Dst T A 1: 34,230,228 (GRCm39) I2785N probably benign Het
Dynap A T 18: 70,374,296 (GRCm39) Y77N possibly damaging Het
Eif4g3 T C 4: 137,910,510 (GRCm39) L1330P possibly damaging Het
Eif4g3 T A 4: 137,925,408 (GRCm39) S1584T probably benign Het
Enpp1 A T 10: 24,555,146 (GRCm39) C67S probably null Het
Enpp5 C T 17: 44,392,027 (GRCm39) T152I probably damaging Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Erc2 T G 14: 27,498,838 (GRCm39) L238R probably damaging Het
Eya3 T A 4: 132,448,698 (GRCm39) probably benign Het
Farp1 T C 14: 121,476,199 (GRCm39) F339L probably damaging Het
Fsip2 A C 2: 82,805,697 (GRCm39) D672A possibly damaging Het
Gap43 G T 16: 42,112,581 (GRCm39) P60Q probably benign Het
Gpr37l1 T A 1: 135,094,783 (GRCm39) I154F probably damaging Het
Greb1 A G 12: 16,746,329 (GRCm39) S1314P probably damaging Het
Hectd4 A T 5: 121,486,505 (GRCm39) M3167L probably benign Het
Hps3 C T 3: 20,084,574 (GRCm39) probably null Het
Hps5 A G 7: 46,436,013 (GRCm39) C178R probably benign Het
Hspg2 T A 4: 137,297,384 (GRCm39) probably benign Het
Impdh2-ps A G 8: 100,757,839 (GRCm39) noncoding transcript Het
Josd2 T A 7: 44,120,678 (GRCm39) N138K probably damaging Het
Mtmr6 T G 14: 60,529,546 (GRCm39) M315R probably damaging Het
Mtrf1 G A 14: 79,650,520 (GRCm39) V323M probably damaging Het
Myo16 G T 8: 10,423,527 (GRCm39) G288W probably damaging Het
Myo18a T C 11: 77,714,149 (GRCm39) Y748H probably damaging Het
Nek1 A T 8: 61,551,545 (GRCm39) N853I probably benign Het
Npnt T G 3: 132,610,452 (GRCm39) T272P possibly damaging Het
Obi1 C T 14: 104,747,819 (GRCm39) D43N probably damaging Het
Or2ag1b C A 7: 106,288,351 (GRCm39) E196* probably null Het
Or2y17 G A 11: 49,232,148 (GRCm39) G263D probably benign Het
Or51e1 T A 7: 102,359,378 (GRCm39) I304N probably damaging Het
Or52n2c G A 7: 104,574,017 (GRCm39) T318I possibly damaging Het
Or5a1 A G 19: 12,097,234 (GRCm39) Y269H possibly damaging Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Pappa2 T G 1: 158,784,572 (GRCm39) D146A probably damaging Het
Pcsk9 C T 4: 106,304,353 (GRCm39) G496R probably damaging Het
Pes1 A G 11: 3,914,058 (GRCm39) K8E probably damaging Het
Phlpp2 G A 8: 110,667,052 (GRCm39) G1194S probably damaging Het
Pkn1 A C 8: 84,398,378 (GRCm39) V763G probably damaging Het
Pkp2 C A 16: 16,048,588 (GRCm39) A331E probably damaging Het
Plb1 T A 5: 32,507,023 (GRCm39) probably null Het
Plxna1 A T 6: 89,309,657 (GRCm39) probably null Het
Polq C T 16: 36,862,109 (GRCm39) T264M probably damaging Het
Prkag3 T C 1: 74,779,864 (GRCm39) *490W probably null Het
Prl2c1 T C 13: 28,041,661 (GRCm39) C228R probably damaging Het
Pus7l T C 15: 94,438,591 (GRCm39) S85G probably benign Het
Rfc3 A C 5: 151,568,241 (GRCm39) probably benign Het
Riox2 A G 16: 59,309,732 (GRCm39) N362S probably benign Het
Scaper A T 9: 55,650,932 (GRCm39) D904E probably damaging Het
Scn11a T C 9: 119,583,627 (GRCm39) M1663V probably benign Het
Slc13a3 A T 2: 165,272,209 (GRCm39) I278N possibly damaging Het
Slc22a7 T C 17: 46,745,923 (GRCm39) E278G probably damaging Het
Snrnp48 T A 13: 38,393,893 (GRCm39) M66K probably damaging Het
Styk1 T G 6: 131,277,429 (GRCm39) E404A probably damaging Het
Synj1 T A 16: 90,752,307 (GRCm39) H1016L probably benign Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tjp2 T C 19: 24,097,475 (GRCm39) probably null Het
Tmem87a A G 2: 120,190,518 (GRCm39) probably null Het
Trappc9 T G 15: 72,808,909 (GRCm39) Y718S probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Ugt2a3 C T 5: 87,475,054 (GRCm39) G397R probably damaging Het
Wdr33 T A 18: 32,019,139 (GRCm39) M454K probably benign Het
Wdtc1 G T 4: 133,029,110 (GRCm39) N325K possibly damaging Het
Whrn T C 4: 63,336,402 (GRCm39) H720R probably damaging Het
Xirp2 A T 2: 67,349,609 (GRCm39) D3268V probably damaging Het
Zc3h7a A T 16: 10,959,573 (GRCm39) H793Q probably damaging Het
Zfp518b C T 5: 38,831,841 (GRCm39) A55T possibly damaging Het
Zmynd8 G A 2: 165,647,249 (GRCm39) T901M probably damaging Het
Other mutations in Or2b6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02513:Or2b6 APN 13 21,823,510 (GRCm39) missense probably damaging 1.00
R0513:Or2b6 UTSW 13 21,823,119 (GRCm39) missense probably benign 0.26
R0928:Or2b6 UTSW 13 21,823,126 (GRCm39) missense probably damaging 1.00
R1440:Or2b6 UTSW 13 21,823,560 (GRCm39) missense probably benign 0.11
R1673:Or2b6 UTSW 13 21,823,214 (GRCm39) missense probably damaging 1.00
R1705:Or2b6 UTSW 13 21,823,331 (GRCm39) missense probably damaging 1.00
R2080:Or2b6 UTSW 13 21,823,606 (GRCm39) missense probably damaging 0.99
R2187:Or2b6 UTSW 13 21,823,555 (GRCm39) missense probably damaging 0.99
R2283:Or2b6 UTSW 13 21,823,190 (GRCm39) missense probably damaging 1.00
R2340:Or2b6 UTSW 13 21,822,757 (GRCm39) missense probably benign 0.03
R3690:Or2b6 UTSW 13 21,823,508 (GRCm39) missense probably damaging 1.00
R4108:Or2b6 UTSW 13 21,822,952 (GRCm39) missense probably damaging 1.00
R4740:Or2b6 UTSW 13 21,823,340 (GRCm39) missense possibly damaging 0.90
R5335:Or2b6 UTSW 13 21,822,949 (GRCm39) missense probably damaging 1.00
R5790:Or2b6 UTSW 13 21,823,046 (GRCm39) missense probably benign
R6320:Or2b6 UTSW 13 21,823,418 (GRCm39) missense probably damaging 1.00
R7406:Or2b6 UTSW 13 21,823,316 (GRCm39) missense probably benign 0.16
R7508:Or2b6 UTSW 13 21,822,779 (GRCm39) missense probably benign 0.19
R8054:Or2b6 UTSW 13 21,823,119 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CAGGACAACTTGAGCAGTGC -3'
(R):5'- TTGGATCCTAAACTCCACACTC -3'

Sequencing Primer
(F):5'- CAACTTGAGCAGTGCAGGCAC -3'
(R):5'- TAAACTCCACACTCCCATGTACTTC -3'
Posted On 2015-11-11