Incidental Mutation 'R4739:Mtrf1'
ID 359548
Institutional Source Beutler Lab
Gene Symbol Mtrf1
Ensembl Gene ENSMUSG00000022022
Gene Name mitochondrial translational release factor 1
Synonyms A830062K05Rik
MMRRC Submission 042025-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R4739 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 79635212-79661027 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79650520 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 323 (V323M)
Ref Sequence ENSEMBL: ENSMUSP00000022600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022600]
AlphaFold Q8K126
Predicted Effect probably damaging
Transcript: ENSMUST00000022600
AA Change: V323M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022
AA Change: V323M

DomainStartEndE-ValueType
low complexity region 104 119 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
PCRF 139 255 5.96e-27 SMART
Pfam:RF-1 290 400 2.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227610
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,796,904 (GRCm39) noncoding transcript Het
2300002M23Rik A G 17: 35,878,403 (GRCm39) probably benign Het
Aadat T C 8: 60,993,140 (GRCm39) V360A probably benign Het
Abcc5 T A 16: 20,218,376 (GRCm39) D283V probably damaging Het
Abraxas1 T A 5: 100,959,886 (GRCm39) K155N probably damaging Het
Acot3 T C 12: 84,105,364 (GRCm39) I277T probably benign Het
Ankrd45 G A 1: 160,982,960 (GRCm39) C157Y probably damaging Het
Apol10a C T 15: 77,372,841 (GRCm39) T159I possibly damaging Het
Arhgef11 G A 3: 87,605,306 (GRCm39) V214M possibly damaging Het
Ash1l A C 3: 88,890,152 (GRCm39) N677T probably benign Het
Atg13 A G 2: 91,515,040 (GRCm39) S254P probably damaging Het
Atg16l2 A G 7: 100,946,385 (GRCm39) L129P probably damaging Het
Avl9 T A 6: 56,703,294 (GRCm39) V120D probably damaging Het
Castor1 A G 11: 4,169,004 (GRCm39) E57G possibly damaging Het
Cc2d1b T C 4: 108,485,239 (GRCm39) V527A probably benign Het
Ccnl1 A G 3: 65,854,092 (GRCm39) probably benign Het
Cenpl T A 1: 160,910,837 (GRCm39) D261E probably damaging Het
Cep192 T G 18: 67,984,803 (GRCm39) I1604M probably benign Het
Cep95 A G 11: 106,706,560 (GRCm39) I573V probably benign Het
Cfap100 A G 6: 90,389,825 (GRCm39) probably null Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cmc1 T A 9: 117,904,245 (GRCm39) M49L probably benign Het
Cyfip2 G T 11: 46,170,820 (GRCm39) N176K probably damaging Het
Cyp2w1 T C 5: 139,342,430 (GRCm39) F408L probably damaging Het
D630045J12Rik G A 6: 38,172,971 (GRCm39) S399F possibly damaging Het
Dcbld2 T A 16: 58,281,339 (GRCm39) L528Q probably damaging Het
Dip2b T C 15: 100,105,658 (GRCm39) V1138A probably damaging Het
Dip2c T A 13: 9,583,375 (GRCm39) L119Q probably damaging Het
Dnah3 T C 7: 119,677,169 (GRCm39) D444G possibly damaging Het
Dsg1c A T 18: 20,408,246 (GRCm39) N432Y possibly damaging Het
Dst T A 1: 34,230,228 (GRCm39) I2785N probably benign Het
Dynap A T 18: 70,374,296 (GRCm39) Y77N possibly damaging Het
Eif4g3 T C 4: 137,910,510 (GRCm39) L1330P possibly damaging Het
Eif4g3 T A 4: 137,925,408 (GRCm39) S1584T probably benign Het
Enpp1 A T 10: 24,555,146 (GRCm39) C67S probably null Het
Enpp5 C T 17: 44,392,027 (GRCm39) T152I probably damaging Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Erc2 T G 14: 27,498,838 (GRCm39) L238R probably damaging Het
Eya3 T A 4: 132,448,698 (GRCm39) probably benign Het
Farp1 T C 14: 121,476,199 (GRCm39) F339L probably damaging Het
Fsip2 A C 2: 82,805,697 (GRCm39) D672A possibly damaging Het
Gap43 G T 16: 42,112,581 (GRCm39) P60Q probably benign Het
Gpr37l1 T A 1: 135,094,783 (GRCm39) I154F probably damaging Het
Greb1 A G 12: 16,746,329 (GRCm39) S1314P probably damaging Het
Hectd4 A T 5: 121,486,505 (GRCm39) M3167L probably benign Het
Hps3 C T 3: 20,084,574 (GRCm39) probably null Het
Hps5 A G 7: 46,436,013 (GRCm39) C178R probably benign Het
Hspg2 T A 4: 137,297,384 (GRCm39) probably benign Het
Impdh2-ps A G 8: 100,757,839 (GRCm39) noncoding transcript Het
Josd2 T A 7: 44,120,678 (GRCm39) N138K probably damaging Het
Mtmr6 T G 14: 60,529,546 (GRCm39) M315R probably damaging Het
Myo16 G T 8: 10,423,527 (GRCm39) G288W probably damaging Het
Myo18a T C 11: 77,714,149 (GRCm39) Y748H probably damaging Het
Nek1 A T 8: 61,551,545 (GRCm39) N853I probably benign Het
Npnt T G 3: 132,610,452 (GRCm39) T272P possibly damaging Het
Obi1 C T 14: 104,747,819 (GRCm39) D43N probably damaging Het
Or2ag1b C A 7: 106,288,351 (GRCm39) E196* probably null Het
Or2b6 T A 13: 21,823,340 (GRCm39) M118L possibly damaging Het
Or2y17 G A 11: 49,232,148 (GRCm39) G263D probably benign Het
Or51e1 T A 7: 102,359,378 (GRCm39) I304N probably damaging Het
Or52n2c G A 7: 104,574,017 (GRCm39) T318I possibly damaging Het
Or5a1 A G 19: 12,097,234 (GRCm39) Y269H possibly damaging Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Pappa2 T G 1: 158,784,572 (GRCm39) D146A probably damaging Het
Pcsk9 C T 4: 106,304,353 (GRCm39) G496R probably damaging Het
Pes1 A G 11: 3,914,058 (GRCm39) K8E probably damaging Het
Phlpp2 G A 8: 110,667,052 (GRCm39) G1194S probably damaging Het
Pkn1 A C 8: 84,398,378 (GRCm39) V763G probably damaging Het
Pkp2 C A 16: 16,048,588 (GRCm39) A331E probably damaging Het
Plb1 T A 5: 32,507,023 (GRCm39) probably null Het
Plxna1 A T 6: 89,309,657 (GRCm39) probably null Het
Polq C T 16: 36,862,109 (GRCm39) T264M probably damaging Het
Prkag3 T C 1: 74,779,864 (GRCm39) *490W probably null Het
Prl2c1 T C 13: 28,041,661 (GRCm39) C228R probably damaging Het
Pus7l T C 15: 94,438,591 (GRCm39) S85G probably benign Het
Rfc3 A C 5: 151,568,241 (GRCm39) probably benign Het
Riox2 A G 16: 59,309,732 (GRCm39) N362S probably benign Het
Scaper A T 9: 55,650,932 (GRCm39) D904E probably damaging Het
Scn11a T C 9: 119,583,627 (GRCm39) M1663V probably benign Het
Slc13a3 A T 2: 165,272,209 (GRCm39) I278N possibly damaging Het
Slc22a7 T C 17: 46,745,923 (GRCm39) E278G probably damaging Het
Snrnp48 T A 13: 38,393,893 (GRCm39) M66K probably damaging Het
Styk1 T G 6: 131,277,429 (GRCm39) E404A probably damaging Het
Synj1 T A 16: 90,752,307 (GRCm39) H1016L probably benign Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tjp2 T C 19: 24,097,475 (GRCm39) probably null Het
Tmem87a A G 2: 120,190,518 (GRCm39) probably null Het
Trappc9 T G 15: 72,808,909 (GRCm39) Y718S probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Ugt2a3 C T 5: 87,475,054 (GRCm39) G397R probably damaging Het
Wdr33 T A 18: 32,019,139 (GRCm39) M454K probably benign Het
Wdtc1 G T 4: 133,029,110 (GRCm39) N325K possibly damaging Het
Whrn T C 4: 63,336,402 (GRCm39) H720R probably damaging Het
Xirp2 A T 2: 67,349,609 (GRCm39) D3268V probably damaging Het
Zc3h7a A T 16: 10,959,573 (GRCm39) H793Q probably damaging Het
Zfp518b C T 5: 38,831,841 (GRCm39) A55T possibly damaging Het
Zmynd8 G A 2: 165,647,249 (GRCm39) T901M probably damaging Het
Other mutations in Mtrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Mtrf1 APN 14 79,660,865 (GRCm39) missense probably benign 0.10
IGL01478:Mtrf1 APN 14 79,640,360 (GRCm39) splice site probably benign
IGL01866:Mtrf1 APN 14 79,638,948 (GRCm39) missense probably benign
IGL02290:Mtrf1 APN 14 79,639,251 (GRCm39) nonsense probably null
IGL02929:Mtrf1 APN 14 79,640,273 (GRCm39) missense probably benign 0.00
IGL03342:Mtrf1 APN 14 79,653,312 (GRCm39) splice site probably null
IGL03342:Mtrf1 APN 14 79,653,311 (GRCm39) splice site probably benign
IGL03342:Mtrf1 APN 14 79,653,420 (GRCm39) missense possibly damaging 0.80
R0212:Mtrf1 UTSW 14 79,656,719 (GRCm39) missense probably benign 0.02
R0560:Mtrf1 UTSW 14 79,644,290 (GRCm39) missense probably damaging 1.00
R0604:Mtrf1 UTSW 14 79,653,327 (GRCm39) missense possibly damaging 0.92
R0669:Mtrf1 UTSW 14 79,656,708 (GRCm39) nonsense probably null
R0981:Mtrf1 UTSW 14 79,639,030 (GRCm39) missense probably benign 0.04
R1837:Mtrf1 UTSW 14 79,639,273 (GRCm39) missense possibly damaging 0.89
R1969:Mtrf1 UTSW 14 79,639,111 (GRCm39) missense probably damaging 1.00
R3883:Mtrf1 UTSW 14 79,656,707 (GRCm39) missense probably damaging 1.00
R4748:Mtrf1 UTSW 14 79,649,090 (GRCm39) missense probably damaging 1.00
R4780:Mtrf1 UTSW 14 79,639,128 (GRCm39) missense probably benign 0.02
R4965:Mtrf1 UTSW 14 79,644,027 (GRCm39) missense probably benign
R5616:Mtrf1 UTSW 14 79,638,885 (GRCm39) missense possibly damaging 0.68
R6530:Mtrf1 UTSW 14 79,640,331 (GRCm39) missense possibly damaging 0.89
R6776:Mtrf1 UTSW 14 79,650,521 (GRCm39) missense probably damaging 1.00
R7095:Mtrf1 UTSW 14 79,660,931 (GRCm39) frame shift probably null
R7182:Mtrf1 UTSW 14 79,660,904 (GRCm39) missense possibly damaging 0.60
R7254:Mtrf1 UTSW 14 79,660,931 (GRCm39) frame shift probably null
R7871:Mtrf1 UTSW 14 79,644,378 (GRCm39) missense probably benign 0.19
R8249:Mtrf1 UTSW 14 79,638,919 (GRCm39) missense probably benign 0.23
R9593:Mtrf1 UTSW 14 79,656,664 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGTGTGCGTAGAAGTAGATTC -3'
(R):5'- GGACCATACCCTCTGAGTGT -3'

Sequencing Primer
(F):5'- GTGCGTAGAAGTAGATTCTTTGG -3'
(R):5'- GGCTTGAGCATTTCAAAGCC -3'
Posted On 2015-11-11