Mutagenetix > Incidental Mutation

Incidental Mutation 'R4739:Trappc9'

359551

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

042025-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4739 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 72937060 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Serine at position 718 (Y718S)

Ref Sequence

ENSEMBL: ENSMUSP00000087202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023276
AA Change: Y539S

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: Y539S

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000089770
AA Change: Y718S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: Y718S

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168191
AA Change: Y718S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: Y718S

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	810	3.7e-222	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170633
AA Change: Y727S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: Y727S

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	820	7.6e-224	PFAM
coiled coil region	857	885	N/A	INTRINSIC
low complexity region	906	929	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230270

Meta Mutation Damage Score

0.3544

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

96% (102/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	T	1: 158,969,334		noncoding transcript	Het
2300002M23Rik	A	G	17: 35,567,506		probably benign	Het
Aadat	T	C	8: 60,540,106	V360A	probably benign	Het
Abcc5	T	A	16: 20,399,626	D283V	probably damaging	Het
Abraxas1	T	A	5: 100,812,020	K155N	probably damaging	Het
Acot3	T	C	12: 84,058,590	I277T	probably benign	Het
Ankrd45	G	A	1: 161,155,390	C157Y	probably damaging	Het
Apol10a	C	T	15: 77,488,641	T159I	possibly damaging	Het
Arhgef11	G	A	3: 87,697,999	V214M	possibly damaging	Het
Ash1l	A	C	3: 88,982,845	N677T	probably benign	Het
Atg13	A	G	2: 91,684,695	S254P	probably damaging	Het
Atg16l2	A	G	7: 101,297,178	L129P	probably damaging	Het
Avl9	T	A	6: 56,726,309	V120D	probably damaging	Het
Cc2d1b	T	C	4: 108,628,042	V527A	probably benign	Het
Ccnl1	A	G	3: 65,946,671		probably benign	Het
Cenpl	T	A	1: 161,083,267	D261E	probably damaging	Het
Cep192	T	G	18: 67,851,732	I1604M	probably benign	Het
Cep95	A	G	11: 106,815,734	I573V	probably benign	Het
Cfap100	A	G	6: 90,412,843		probably null	Het
Cmc1	T	A	9: 118,075,177	M49L	probably benign	Het
Cyfip2	G	T	11: 46,279,993	N176K	probably damaging	Het
Cyp2w1	T	C	5: 139,356,675	F408L	probably damaging	Het
D630045J12Rik	G	A	6: 38,196,036	S399F	possibly damaging	Het
Dcbld2	T	A	16: 58,460,976	L528Q	probably damaging	Het
Dip2b	T	C	15: 100,207,777	V1138A	probably damaging	Het
Dip2c	T	A	13: 9,533,339	L119Q	probably damaging	Het
Dnah3	T	C	7: 120,077,946	D444G	possibly damaging	Het
Dsg1c	A	T	18: 20,275,189	N432Y	possibly damaging	Het
Dst	T	A	1: 34,191,147	I2785N	probably benign	Het
Dynap	A	T	18: 70,241,225	Y77N	possibly damaging	Het
Eif4g3	T	C	4: 138,183,199	L1330P	possibly damaging	Het
Eif4g3	T	A	4: 138,198,097	S1584T	probably benign	Het
Enpp1	A	T	10: 24,679,248	C67S	probably null	Het
Enpp5	C	T	17: 44,081,136	T152I	probably damaging	Het
Erbb4	T	C	1: 68,343,900	M313V	probably damaging	Het
Erc2	T	G	14: 27,776,881	L238R	probably damaging	Het
Eya3	T	A	4: 132,721,387		probably benign	Het
Farp1	T	C	14: 121,238,787	F339L	probably damaging	Het
Fsip2	A	C	2: 82,975,353	D672A	possibly damaging	Het
Gap43	G	T	16: 42,292,218	P60Q	probably benign	Het
Gatsl3	A	G	11: 4,219,004	E57G	possibly damaging	Het
Gpr37l1	T	A	1: 135,167,045	I154F	probably damaging	Het
Greb1	A	G	12: 16,696,328	S1314P	probably damaging	Het
Hectd4	A	T	5: 121,348,442	M3167L	probably benign	Het
Hps3	C	T	3: 20,030,410		probably null	Het
Hps5	A	G	7: 46,786,589	C178R	probably benign	Het
Hspg2	T	A	4: 137,570,073		probably benign	Het
Impdh2-ps	A	G	8: 100,031,207		noncoding transcript	Het
Josd2	T	A	7: 44,471,254	N138K	probably damaging	Het
Mtmr6	T	G	14: 60,292,097	M315R	probably damaging	Het
Mtrf1	G	A	14: 79,413,080	V323M	probably damaging	Het
Myo16	G	T	8: 10,373,527	G288W	probably damaging	Het
Myo18a	T	C	11: 77,823,323	Y748H	probably damaging	Het
Narfl	A	T	17: 25,781,309	H322L	probably damaging	Het
Nek1	A	T	8: 61,098,511	N853I	probably benign	Het
Npnt	T	G	3: 132,904,691	T272P	possibly damaging	Het
Olfr11	T	A	13: 21,639,170	M118L	possibly damaging	Het
Olfr1390	G	A	11: 49,341,321	G263D	probably benign	Het
Olfr558	T	A	7: 102,710,171	I304N	probably damaging	Het
Olfr668	G	A	7: 104,924,810	T318I	possibly damaging	Het
Olfr694	C	A	7: 106,689,144	E196*	probably null	Het
Olfr76	A	G	19: 12,119,870	Y269H	possibly damaging	Het
Pappa2	T	G	1: 158,957,002	D146A	probably damaging	Het
Pappa2	T	C	1: 158,957,012	R143G	probably benign	Het
Pcsk9	C	T	4: 106,447,156	G496R	probably damaging	Het
Pes1	A	G	11: 3,964,058	K8E	probably damaging	Het
Phlpp2	G	A	8: 109,940,420	G1194S	probably damaging	Het
Pkn1	A	C	8: 83,671,749	V763G	probably damaging	Het
Pkp2	C	A	16: 16,230,724	A331E	probably damaging	Het
Plb1	T	A	5: 32,349,679		probably null	Het
Plxna1	A	T	6: 89,332,675		probably null	Het
Polq	C	T	16: 37,041,747	T264M	probably damaging	Het
Prkag3	T	C	1: 74,740,705	*490W	probably null	Het
Prl2c1	T	C	13: 27,857,678	C228R	probably damaging	Het
Pus7l	T	C	15: 94,540,710	S85G	probably benign	Het
Rfc3	A	C	5: 151,644,776		probably benign	Het
Riox2	A	G	16: 59,489,369	N362S	probably benign	Het
Rnf219	C	T	14: 104,510,383	D43N	probably damaging	Het
Scaper	A	T	9: 55,743,648	D904E	probably damaging	Het
Scn11a	T	C	9: 119,754,561	M1663V	probably benign	Het
Slc13a3	A	T	2: 165,430,289	I278N	possibly damaging	Het
Slc22a7	T	C	17: 46,434,997	E278G	probably damaging	Het
Snrnp48	T	A	13: 38,209,917	M66K	probably damaging	Het
Styk1	T	G	6: 131,300,466	E404A	probably damaging	Het
Synj1	T	A	16: 90,955,419	H1016L	probably benign	Het
Tbc1d8	G	A	1: 39,402,878	T211I	possibly damaging	Het
Tjp2	T	C	19: 24,120,111		probably null	Het
Tmem87a	A	G	2: 120,360,037		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Ugt2a3	C	T	5: 87,327,195	G397R	probably damaging	Het
Wdr33	T	A	18: 31,886,086	M454K	probably benign	Het
Wdtc1	G	T	4: 133,301,799	N325K	possibly damaging	Het
Whrn	T	C	4: 63,418,165	H720R	probably damaging	Het
Xirp2	A	T	2: 67,519,265	D3268V	probably damaging	Het
Zc3h7a	A	T	16: 11,141,709	H793Q	probably damaging	Het
Zfp518b	C	T	5: 38,674,498	A55T	possibly damaging	Het
Zmynd8	G	A	2: 165,805,329	T901M	probably damaging	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
bronto	UTSW	15	73058238	nonsense	probably null
Earl	UTSW	15	72736777	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8683:Trappc9	UTSW	15	73012815	missense	probably benign	0.26
R8839:Trappc9	UTSW	15	73058238	nonsense	probably null
R8945:Trappc9	UTSW	15	73058096	missense	probably benign
R9083:Trappc9	UTSW	15	72736777	nonsense	probably null
R9323:Trappc9	UTSW	15	72693582	missense	probably benign	0.41
R9329:Trappc9	UTSW	15	72801353	missense	unknown
R9366:Trappc9	UTSW	15	72937088	missense	probably benign
R9723:Trappc9	UTSW	15	72590114	missense	possibly damaging	0.87
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- ATTAGATTTCCTGGTGACTCGG -3'
(R):5'- TGAGCCCCAAATTCTGTGTG -3'

Sequencing Primer
(F):5'- ACTCGGTTTCACTTTGGGTAAC -3'
(R):5'- CCCAAATTCTGTGTGTAAAGCCAGG -3'

Posted On

2015-11-11