Mutagenetix > Incidental Mutations

Incidental Mutation 'R4739:Trappc9'

359551

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

042025-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4739 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 72937060 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Serine at position 718 (Y718S)

Ref Sequence

ENSEMBL: ENSMUSP00000087202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023276
AA Change: Y539S

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: Y539S

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000089770
AA Change: Y718S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: Y718S

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168191
AA Change: Y718S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: Y718S

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	810	3.7e-222	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170633
AA Change: Y727S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: Y727S

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	820	7.6e-224	PFAM
coiled coil region	857	885	N/A	INTRINSIC
low complexity region	906	929	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230270

Meta Mutation Damage Score

0.3544

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

96% (102/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	T	1: 158,969,334		noncoding transcript	Het
2300002M23Rik	A	G	17: 35,567,506		probably benign	Het
Aadat	T	C	8: 60,540,106	V360A	probably benign	Het
Abcc5	T	A	16: 20,399,626	D283V	probably damaging	Het
Abraxas1	T	A	5: 100,812,020	K155N	probably damaging	Het
Acot3	T	C	12: 84,058,590	I277T	probably benign	Het
Ankrd45	G	A	1: 161,155,390	C157Y	probably damaging	Het
Apol10a	C	T	15: 77,488,641	T159I	possibly damaging	Het
Arhgef11	G	A	3: 87,697,999	V214M	possibly damaging	Het
Ash1l	A	C	3: 88,982,845	N677T	probably benign	Het
Atg13	A	G	2: 91,684,695	S254P	probably damaging	Het
Atg16l2	A	G	7: 101,297,178	L129P	probably damaging	Het
Avl9	T	A	6: 56,726,309	V120D	probably damaging	Het
Cc2d1b	T	C	4: 108,628,042	V527A	probably benign	Het
Ccnl1	A	G	3: 65,946,671		probably benign	Het
Cenpl	T	A	1: 161,083,267	D261E	probably damaging	Het
Cep192	T	G	18: 67,851,732	I1604M	probably benign	Het
Cep95	A	G	11: 106,815,734	I573V	probably benign	Het
Cfap100	A	G	6: 90,412,843		probably null	Het
Cmc1	T	A	9: 118,075,177	M49L	probably benign	Het
Cyfip2	G	T	11: 46,279,993	N176K	probably damaging	Het
Cyp2w1	T	C	5: 139,356,675	F408L	probably damaging	Het
D630045J12Rik	G	A	6: 38,196,036	S399F	possibly damaging	Het
Dcbld2	T	A	16: 58,460,976	L528Q	probably damaging	Het
Dip2b	T	C	15: 100,207,777	V1138A	probably damaging	Het
Dip2c	T	A	13: 9,533,339	L119Q	probably damaging	Het
Dnah3	T	C	7: 120,077,946	D444G	possibly damaging	Het
Dsg1c	A	T	18: 20,275,189	N432Y	possibly damaging	Het
Dst	T	A	1: 34,191,147	I2785N	probably benign	Het
Dynap	A	T	18: 70,241,225	Y77N	possibly damaging	Het
Eif4g3	T	C	4: 138,183,199	L1330P	possibly damaging	Het
Eif4g3	T	A	4: 138,198,097	S1584T	probably benign	Het
Enpp1	A	T	10: 24,679,248	C67S	probably null	Het
Enpp5	C	T	17: 44,081,136	T152I	probably damaging	Het
Erbb4	T	C	1: 68,343,900	M313V	probably damaging	Het
Erc2	T	G	14: 27,776,881	L238R	probably damaging	Het
Eya3	T	A	4: 132,721,387		probably benign	Het
Farp1	T	C	14: 121,238,787	F339L	probably damaging	Het
Fsip2	A	C	2: 82,975,353	D672A	possibly damaging	Het
Gap43	G	T	16: 42,292,218	P60Q	probably benign	Het
Gatsl3	A	G	11: 4,219,004	E57G	possibly damaging	Het
Gpr37l1	T	A	1: 135,167,045	I154F	probably damaging	Het
Greb1	A	G	12: 16,696,328	S1314P	probably damaging	Het
Hectd4	A	T	5: 121,348,442	M3167L	probably benign	Het
Hps3	C	T	3: 20,030,410		probably null	Het
Hps5	A	G	7: 46,786,589	C178R	probably benign	Het
Hspg2	T	A	4: 137,570,073		probably benign	Het
Impdh2-ps	A	G	8: 100,031,207		noncoding transcript	Het
Josd2	T	A	7: 44,471,254	N138K	probably damaging	Het
Mtmr6	T	G	14: 60,292,097	M315R	probably damaging	Het
Mtrf1	G	A	14: 79,413,080	V323M	probably damaging	Het
Myo16	G	T	8: 10,373,527	G288W	probably damaging	Het
Myo18a	T	C	11: 77,823,323	Y748H	probably damaging	Het
Narfl	A	T	17: 25,781,309	H322L	probably damaging	Het
Nek1	A	T	8: 61,098,511	N853I	probably benign	Het
Npnt	T	G	3: 132,904,691	T272P	possibly damaging	Het
Olfr11	T	A	13: 21,639,170	M118L	possibly damaging	Het
Olfr1390	G	A	11: 49,341,321	G263D	probably benign	Het
Olfr558	T	A	7: 102,710,171	I304N	probably damaging	Het
Olfr668	G	A	7: 104,924,810	T318I	possibly damaging	Het
Olfr694	C	A	7: 106,689,144	E196*	probably null	Het
Olfr76	A	G	19: 12,119,870	Y269H	possibly damaging	Het
Pappa2	T	G	1: 158,957,002	D146A	probably damaging	Het
Pappa2	T	C	1: 158,957,012	R143G	probably benign	Het
Pcsk9	C	T	4: 106,447,156	G496R	probably damaging	Het
Pes1	A	G	11: 3,964,058	K8E	probably damaging	Het
Phlpp2	G	A	8: 109,940,420	G1194S	probably damaging	Het
Pkn1	A	C	8: 83,671,749	V763G	probably damaging	Het
Pkp2	C	A	16: 16,230,724	A331E	probably damaging	Het
Plb1	T	A	5: 32,349,679		probably null	Het
Plxna1	A	T	6: 89,332,675		probably null	Het
Polq	C	T	16: 37,041,747	T264M	probably damaging	Het
Prkag3	T	C	1: 74,740,705	*490W	probably null	Het
Prl2c1	T	C	13: 27,857,678	C228R	probably damaging	Het
Pus7l	T	C	15: 94,540,710	S85G	probably benign	Het
Rfc3	A	C	5: 151,644,776		probably benign	Het
Riox2	A	G	16: 59,489,369	N362S	probably benign	Het
Rnf219	C	T	14: 104,510,383	D43N	probably damaging	Het
Scaper	A	T	9: 55,743,648	D904E	probably damaging	Het
Scn11a	T	C	9: 119,754,561	M1663V	probably benign	Het
Slc13a3	A	T	2: 165,430,289	I278N	possibly damaging	Het
Slc22a7	T	C	17: 46,434,997	E278G	probably damaging	Het
Snrnp48	T	A	13: 38,209,917	M66K	probably damaging	Het
Styk1	T	G	6: 131,300,466	E404A	probably damaging	Het
Synj1	T	A	16: 90,955,419	H1016L	probably benign	Het
Tbc1d8	G	A	1: 39,402,878	T211I	possibly damaging	Het
Tjp2	T	C	19: 24,120,111		probably null	Het
Tmem87a	A	G	2: 120,360,037		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Ugt2a3	C	T	5: 87,327,195	G397R	probably damaging	Het
Wdr33	T	A	18: 31,886,086	M454K	probably benign	Het
Wdtc1	G	T	4: 133,301,799	N325K	possibly damaging	Het
Whrn	T	C	4: 63,418,165	H720R	probably damaging	Het
Xirp2	A	T	2: 67,519,265	D3268V	probably damaging	Het
Zc3h7a	A	T	16: 11,141,709	H793Q	probably damaging	Het
Zfp518b	C	T	5: 38,674,498	A55T	possibly damaging	Het
Zmynd8	G	A	2: 165,805,329	T901M	probably damaging	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- ATTAGATTTCCTGGTGACTCGG -3'
(R):5'- TGAGCCCCAAATTCTGTGTG -3'

Sequencing Primer
(F):5'- ACTCGGTTTCACTTTGGGTAAC -3'
(R):5'- CCCAAATTCTGTGTGTAAAGCCAGG -3'

Posted On

2015-11-11