Mutagenetix > Incidental Mutations

Incidental Mutation 'R4739:Dip2b'

359554

Institutional Source

Beutler Lab

Gene Symbol

Dip2b

Ensembl Gene

ENSMUSG00000023026

Gene Name

disco interacting protein 2 homolog B

Synonyms

MMRRC Submission

042025-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.661) question?

Stock #

R4739 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100038664-100219473 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100207777 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1138 (V1138A)

Ref Sequence

ENSEMBL: ENSMUSP00000023768 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023768
AA Change: V1138A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: V1138A

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	109	584	9.5e-26	PFAM
Pfam:AMP-binding	760	1235	1.2e-52	PFAM
low complexity region	1299	1311	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100203
AA Change: V1372A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: V1372A

Domain	Start	End	E-Value	Type
DMAP_binding	12	130	1e-42	SMART
low complexity region	152	168	N/A	INTRINSIC
low complexity region	181	192	N/A	INTRINSIC
Pfam:AMP-binding	341	817	2e-26	PFAM
Pfam:AMP-binding	993	1468	1.8e-64	PFAM
low complexity region	1532	1544	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108971
AA Change: V1138A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: V1138A

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	108	583	9.5e-26	PFAM
Pfam:AMP-binding	759	1234	1.2e-52	PFAM
low complexity region	1298	1310	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135658

Meta Mutation Damage Score

0.5980

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

96% (102/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	T	1: 158,969,334		noncoding transcript	Het
2300002M23Rik	A	G	17: 35,567,506		probably benign	Het
Aadat	T	C	8: 60,540,106	V360A	probably benign	Het
Abcc5	T	A	16: 20,399,626	D283V	probably damaging	Het
Abraxas1	T	A	5: 100,812,020	K155N	probably damaging	Het
Acot3	T	C	12: 84,058,590	I277T	probably benign	Het
Ankrd45	G	A	1: 161,155,390	C157Y	probably damaging	Het
Apol10a	C	T	15: 77,488,641	T159I	possibly damaging	Het
Arhgef11	G	A	3: 87,697,999	V214M	possibly damaging	Het
Ash1l	A	C	3: 88,982,845	N677T	probably benign	Het
Atg13	A	G	2: 91,684,695	S254P	probably damaging	Het
Atg16l2	A	G	7: 101,297,178	L129P	probably damaging	Het
Avl9	T	A	6: 56,726,309	V120D	probably damaging	Het
Cc2d1b	T	C	4: 108,628,042	V527A	probably benign	Het
Ccnl1	A	G	3: 65,946,671		probably benign	Het
Cenpl	T	A	1: 161,083,267	D261E	probably damaging	Het
Cep192	T	G	18: 67,851,732	I1604M	probably benign	Het
Cep95	A	G	11: 106,815,734	I573V	probably benign	Het
Cfap100	A	G	6: 90,412,843		probably null	Het
Cmc1	T	A	9: 118,075,177	M49L	probably benign	Het
Cyfip2	G	T	11: 46,279,993	N176K	probably damaging	Het
Cyp2w1	T	C	5: 139,356,675	F408L	probably damaging	Het
D630045J12Rik	G	A	6: 38,196,036	S399F	possibly damaging	Het
Dcbld2	T	A	16: 58,460,976	L528Q	probably damaging	Het
Dip2c	T	A	13: 9,533,339	L119Q	probably damaging	Het
Dnah3	T	C	7: 120,077,946	D444G	possibly damaging	Het
Dsg1c	A	T	18: 20,275,189	N432Y	possibly damaging	Het
Dst	T	A	1: 34,191,147	I2785N	probably benign	Het
Dynap	A	T	18: 70,241,225	Y77N	possibly damaging	Het
Eif4g3	T	C	4: 138,183,199	L1330P	possibly damaging	Het
Eif4g3	T	A	4: 138,198,097	S1584T	probably benign	Het
Enpp1	A	T	10: 24,679,248	C67S	probably null	Het
Enpp5	C	T	17: 44,081,136	T152I	probably damaging	Het
Erbb4	T	C	1: 68,343,900	M313V	probably damaging	Het
Erc2	T	G	14: 27,776,881	L238R	probably damaging	Het
Eya3	T	A	4: 132,721,387		probably benign	Het
Farp1	T	C	14: 121,238,787	F339L	probably damaging	Het
Fsip2	A	C	2: 82,975,353	D672A	possibly damaging	Het
Gap43	G	T	16: 42,292,218	P60Q	probably benign	Het
Gatsl3	A	G	11: 4,219,004	E57G	possibly damaging	Het
Gpr37l1	T	A	1: 135,167,045	I154F	probably damaging	Het
Greb1	A	G	12: 16,696,328	S1314P	probably damaging	Het
Hectd4	A	T	5: 121,348,442	M3167L	probably benign	Het
Hps3	C	T	3: 20,030,410		probably null	Het
Hps5	A	G	7: 46,786,589	C178R	probably benign	Het
Hspg2	T	A	4: 137,570,073		probably benign	Het
Impdh2-ps	A	G	8: 100,031,207		noncoding transcript	Het
Josd2	T	A	7: 44,471,254	N138K	probably damaging	Het
Mtmr6	T	G	14: 60,292,097	M315R	probably damaging	Het
Mtrf1	G	A	14: 79,413,080	V323M	probably damaging	Het
Myo16	G	T	8: 10,373,527	G288W	probably damaging	Het
Myo18a	T	C	11: 77,823,323	Y748H	probably damaging	Het
Narfl	A	T	17: 25,781,309	H322L	probably damaging	Het
Nek1	A	T	8: 61,098,511	N853I	probably benign	Het
Npnt	T	G	3: 132,904,691	T272P	possibly damaging	Het
Olfr11	T	A	13: 21,639,170	M118L	possibly damaging	Het
Olfr1390	G	A	11: 49,341,321	G263D	probably benign	Het
Olfr558	T	A	7: 102,710,171	I304N	probably damaging	Het
Olfr668	G	A	7: 104,924,810	T318I	possibly damaging	Het
Olfr694	C	A	7: 106,689,144	E196*	probably null	Het
Olfr76	A	G	19: 12,119,870	Y269H	possibly damaging	Het
Pappa2	T	G	1: 158,957,002	D146A	probably damaging	Het
Pappa2	T	C	1: 158,957,012	R143G	probably benign	Het
Pcsk9	C	T	4: 106,447,156	G496R	probably damaging	Het
Pes1	A	G	11: 3,964,058	K8E	probably damaging	Het
Phlpp2	G	A	8: 109,940,420	G1194S	probably damaging	Het
Pkn1	A	C	8: 83,671,749	V763G	probably damaging	Het
Pkp2	C	A	16: 16,230,724	A331E	probably damaging	Het
Plb1	T	A	5: 32,349,679		probably null	Het
Plxna1	A	T	6: 89,332,675		probably null	Het
Polq	C	T	16: 37,041,747	T264M	probably damaging	Het
Prkag3	T	C	1: 74,740,705	*490W	probably null	Het
Prl2c1	T	C	13: 27,857,678	C228R	probably damaging	Het
Pus7l	T	C	15: 94,540,710	S85G	probably benign	Het
Rfc3	A	C	5: 151,644,776		probably benign	Het
Riox2	A	G	16: 59,489,369	N362S	probably benign	Het
Rnf219	C	T	14: 104,510,383	D43N	probably damaging	Het
Scaper	A	T	9: 55,743,648	D904E	probably damaging	Het
Scn11a	T	C	9: 119,754,561	M1663V	probably benign	Het
Slc13a3	A	T	2: 165,430,289	I278N	possibly damaging	Het
Slc22a7	T	C	17: 46,434,997	E278G	probably damaging	Het
Snrnp48	T	A	13: 38,209,917	M66K	probably damaging	Het
Styk1	T	G	6: 131,300,466	E404A	probably damaging	Het
Synj1	T	A	16: 90,955,419	H1016L	probably benign	Het
Tbc1d8	G	A	1: 39,402,878	T211I	possibly damaging	Het
Tjp2	T	C	19: 24,120,111		probably null	Het
Tmem87a	A	G	2: 120,360,037		probably null	Het
Trappc9	T	G	15: 72,937,060	Y718S	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Ugt2a3	C	T	5: 87,327,195	G397R	probably damaging	Het
Wdr33	T	A	18: 31,886,086	M454K	probably benign	Het
Wdtc1	G	T	4: 133,301,799	N325K	possibly damaging	Het
Whrn	T	C	4: 63,418,165	H720R	probably damaging	Het
Xirp2	A	T	2: 67,519,265	D3268V	probably damaging	Het
Zc3h7a	A	T	16: 11,141,709	H793Q	probably damaging	Het
Zfp518b	C	T	5: 38,674,498	A55T	possibly damaging	Het
Zmynd8	G	A	2: 165,805,329	T901M	probably damaging	Het

Other mutations in Dip2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Dip2b	APN	15	100174501	missense	probably damaging	1.00
IGL01716:Dip2b	APN	15	100209636	missense	probably benign	0.00
IGL01893:Dip2b	APN	15	100171220	splice site	probably benign
IGL01915:Dip2b	APN	15	100178511	missense	probably damaging	1.00
IGL02125:Dip2b	APN	15	100186250	missense	possibly damaging	0.60
IGL02200:Dip2b	APN	15	100151202	missense	possibly damaging	0.93
IGL02506:Dip2b	APN	15	100157281	missense	probably damaging	1.00
IGL02571:Dip2b	APN	15	100157885	missense	possibly damaging	0.93
IGL02706:Dip2b	APN	15	100215311	missense	probably damaging	0.98
IGL02983:Dip2b	APN	15	100132022	missense	possibly damaging	0.81
IGL03120:Dip2b	APN	15	100203127	splice site	probably benign
IGL03181:Dip2b	APN	15	100215207	missense	probably damaging	0.98
IGL03229:Dip2b	APN	15	100207838	splice site	probably benign
IGL03399:Dip2b	APN	15	100175327	missense	possibly damaging	0.63
PIT4131001:Dip2b	UTSW	15	100202352	missense	probably damaging	1.00
R0009:Dip2b	UTSW	15	100169312	missense	probably damaging	1.00
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0092:Dip2b	UTSW	15	100202265	missense	probably damaging	1.00
R0201:Dip2b	UTSW	15	100186147	missense	probably damaging	0.98
R0359:Dip2b	UTSW	15	100211993	missense	probably damaging	0.98
R0390:Dip2b	UTSW	15	100193913	missense	probably damaging	0.99
R0564:Dip2b	UTSW	15	100162719	nonsense	probably null
R0730:Dip2b	UTSW	15	100171651	missense	probably damaging	1.00
R1144:Dip2b	UTSW	15	100154250	missense	probably benign	0.11
R1200:Dip2b	UTSW	15	100209745	missense	probably benign	0.00
R1506:Dip2b	UTSW	15	100183113	missense	probably damaging	1.00
R1750:Dip2b	UTSW	15	100178466	missense	probably benign
R1760:Dip2b	UTSW	15	100212029	missense	probably damaging	1.00
R1773:Dip2b	UTSW	15	100193961	missense	probably benign	0.00
R1812:Dip2b	UTSW	15	100198938	unclassified	probably null
R2264:Dip2b	UTSW	15	100203216	missense	probably benign	0.05
R3105:Dip2b	UTSW	15	100142137	nonsense	probably null
R4029:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4030:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4296:Dip2b	UTSW	15	100181336	missense	probably benign
R4392:Dip2b	UTSW	15	100162036	missense	probably damaging	1.00
R4480:Dip2b	UTSW	15	100186301	missense	probably damaging	0.99
R4564:Dip2b	UTSW	15	100157258	nonsense	probably null
R4605:Dip2b	UTSW	15	100209636	missense	probably benign	0.00
R4606:Dip2b	UTSW	15	100215329	missense	possibly damaging	0.91
R4634:Dip2b	UTSW	15	100160491	missense	probably damaging	1.00
R4667:Dip2b	UTSW	15	100151360	missense	probably benign	0.01
R4826:Dip2b	UTSW	15	100169281	missense	probably damaging	0.99
R4870:Dip2b	UTSW	15	100195784	unclassified	probably null
R4877:Dip2b	UTSW	15	100160529	missense	possibly damaging	0.49
R4932:Dip2b	UTSW	15	100171722	missense	probably damaging	1.00
R5009:Dip2b	UTSW	15	100195784	unclassified	probably null
R5169:Dip2b	UTSW	15	100205113	missense	probably damaging	1.00
R5216:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5218:Dip2b	UTSW	15	100154296	missense	probably benign	0.00
R5274:Dip2b	UTSW	15	100212104	missense	possibly damaging	0.54
R5370:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5420:Dip2b	UTSW	15	100205173	intron	probably benign
R5447:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5670:Dip2b	UTSW	15	100190104	missense	possibly damaging	0.80
R5768:Dip2b	UTSW	15	100157945	missense	probably benign	0.32
R5908:Dip2b	UTSW	15	100151184	missense	possibly damaging	0.93
R5957:Dip2b	UTSW	15	100209694	missense	probably benign	0.03
R5987:Dip2b	UTSW	15	100190079	missense	probably damaging	1.00
R6260:Dip2b	UTSW	15	100162702	missense	probably benign	0.05
R6325:Dip2b	UTSW	15	100154282	missense	probably benign	0.00
R6367:Dip2b	UTSW	15	100115914	missense	possibly damaging	0.50
R6391:Dip2b	UTSW	15	100151276	missense	probably damaging	1.00
R6422:Dip2b	UTSW	15	100199011	missense	probably damaging	0.98
R6818:Dip2b	UTSW	15	100193954	missense	probably benign	0.09
R6922:Dip2b	UTSW	15	100193843	missense	probably benign	0.25
R7002:Dip2b	UTSW	15	100160465	missense	probably benign	0.43
R7076:Dip2b	UTSW	15	100157972	splice site	probably null
R7176:Dip2b	UTSW	15	100169318	missense	probably damaging	1.00
R7255:Dip2b	UTSW	15	100209627	missense	probably benign	0.00
R7463:Dip2b	UTSW	15	100154157	missense	probably benign
R7513:Dip2b	UTSW	15	100207748	splice site	probably null
R7876:Dip2b	UTSW	15	100191041	missense	probably benign	0.02
R8368:Dip2b	UTSW	15	100154243	missense	probably benign	0.00
X0064:Dip2b	UTSW	15	100115850	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGACCCTTTGAGTGATGGC -3'
(R):5'- AAATCCAGGATTCCCAATAGAGG -3'

Sequencing Primer
(F):5'- CCCTTTGAGTGATGGCTGCTTC -3'
(R):5'- GGAATGCAGTGGAGTCCAGTTC -3'

Posted On

2015-11-11