Mutagenetix > Incidental Mutations

Incidental Mutation 'R4740:Mertk'

359586

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

041965-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.142) question?

Stock #

R4740 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128751994 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 306 (Y306C)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

Predicted Effect

probably damaging
Transcript: ENSMUST00000014505
AA Change: Y306C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: Y306C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145178

Meta Mutation Damage Score

0.2255

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (95/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	A	C	1: 93,156,168	M189R	probably benign	Het
2510009E07Rik	C	T	16: 21,694,396	A4T	probably benign	Het
4932415D10Rik	T	C	10: 82,283,647	T4510A	possibly damaging	Het
Aacs	T	C	5: 125,506,252	S291P	probably damaging	Het
Abcb1a	T	C	5: 8,702,280		probably null	Het
Apol10a	C	T	15: 77,488,641	T159I	possibly damaging	Het
Arhgap5	A	T	12: 52,519,077	M944L	probably benign	Het
Atg16l2	A	G	7: 101,297,178	L129P	probably damaging	Het
Baiap2l2	T	A	15: 79,259,751	Y381F	probably benign	Het
Chd6	A	T	2: 160,970,183	D1363E	probably benign	Het
Cir1	T	C	2: 73,312,523		probably benign	Het
Clec4a2	T	C	6: 123,140,663	I180T	probably damaging	Het
Clec4d	T	A	6: 123,268,113	H117Q	probably damaging	Het
Cntnap2	A	T	6: 45,060,317	R10W	possibly damaging	Het
Coro6	A	G	11: 77,469,199	E362G	possibly damaging	Het
Ctr9	T	A	7: 111,035,371	C196S	probably benign	Het
Cyp2c55	A	G	19: 39,018,729	K190E	probably benign	Het
Dbt	T	C	3: 116,539,132	I200T	probably damaging	Het
Dnah11	A	G	12: 118,120,544	F1242L	probably benign	Het
Dnah2	A	G	11: 69,458,042	W2534R	probably damaging	Het
Dph7	T	C	2: 24,963,131	S86P	possibly damaging	Het
Dpp9	A	C	17: 56,198,970		probably null	Het
Eif4g3	T	A	4: 138,198,097	S1584T	probably benign	Het
Eml4	T	G	17: 83,410,030	D10E	probably damaging	Het
Enpp1	A	T	10: 24,679,248	C67S	probably null	Het
Epn1	A	G	7: 5,090,013	D108G	probably damaging	Het
Eps15	A	G	4: 109,343,190	Y2C	probably damaging	Het
Fam135b	C	T	15: 71,464,071	V425I	probably benign	Het
Frem2	G	A	3: 53,535,819	A2508V	probably benign	Het
Fzd3	T	A	14: 65,235,744	M192L	possibly damaging	Het
Gls	C	T	1: 52,232,788	A69T	probably damaging	Het
Gm10051	T	A	5: 133,475,274		noncoding transcript	Het
Gm4759	G	A	7: 106,423,575		noncoding transcript	Het
Gm8909	T	A	17: 36,167,556	I195F	probably damaging	Het
Gm9271	A	G	7: 39,363,922		noncoding transcript	Het
Gramd1b	T	C	9: 40,315,832		probably null	Het
H2-T23	A	T	17: 36,032,124		probably benign	Het
Hmbox1	G	A	14: 64,897,034	T39I	probably damaging	Het
Hmx1	A	G	5: 35,391,771	E136G	probably damaging	Het
Hpdl	T	C	4: 116,821,024	N80S	probably damaging	Het
Hydin	A	G	8: 110,446,439	N918S	probably benign	Het
Igkv5-37	T	A	6: 69,963,322	S113C	probably damaging	Het
Il1f5	T	C	2: 24,277,491		probably benign	Het
Marco	G	T	1: 120,494,770	T61K	probably damaging	Het
Med1	T	A	11: 98,180,264	R86*	probably null	Het
Mgat4c	T	C	10: 102,388,404	F160L	probably damaging	Het
Midn	A	T	10: 80,151,404	E88V	probably null	Het
Muc4	G	A	16: 32,775,903	R3163H	possibly damaging	Het
Naip1	T	C	13: 100,444,526	D71G	possibly damaging	Het
Narfl	A	T	17: 25,781,309	H322L	probably damaging	Het
Nhlrc4	T	C	17: 25,943,603	T57A	probably benign	Het
Nlrp1a	T	C	11: 71,113,640		probably null	Het
Npffr2	A	T	5: 89,583,020	K270*	probably null	Het
Olfr1090	C	T	2: 86,753,811	C309Y	probably benign	Het
Olfr11	T	A	13: 21,639,170	M118L	possibly damaging	Het
Olfr518	T	G	7: 108,881,482	E41D	probably benign	Het
Olfr558	T	A	7: 102,710,171	I304N	probably damaging	Het
Olfr943	T	A	9: 39,184,368	Y60*	probably null	Het
Otub2	T	A	12: 103,392,844	L64Q	probably benign	Het
Pabpc4l	C	G	3: 46,446,135	G358A	possibly damaging	Het
Pabpc4l	C	T	3: 46,446,144	R355H	probably benign	Het
Parp1	T	C	1: 180,589,468	S606P	probably damaging	Het
Pkhd1	A	G	1: 20,524,130	V1253A	probably benign	Het
Psg29	G	A	7: 17,208,533	R153H	probably benign	Het
Rbm25	A	G	12: 83,644,407	M58V	possibly damaging	Het
Rbm28	T	C	6: 29,125,354		probably benign	Het
Ryr2	A	G	13: 11,657,047	S3436P	possibly damaging	Het
Slc3a1	A	G	17: 85,046,753	I335V	probably benign	Het
Slc4a4	T	C	5: 89,225,894	F953S	probably damaging	Het
Spata20	A	G	11: 94,484,578	I130T	possibly damaging	Het
Srcap	T	C	7: 127,549,299	S1879P	probably damaging	Het
St18	G	C	1: 6,817,604	V466L	probably benign	Het
Stard3nl	A	T	13: 19,367,778	M166K	probably benign	Het
Stard3nl	G	A	13: 19,376,566	T13M	probably damaging	Het
Stil	A	G	4: 115,006,782	T74A	probably benign	Het
Syt6	T	G	3: 103,625,656	M367R	probably damaging	Het
Tacc1	T	C	8: 25,182,565	T125A	possibly damaging	Het
Tbc1d8	G	A	1: 39,402,878	T211I	possibly damaging	Het
Tcaf1	A	G	6: 42,686,875	S24P	probably benign	Het
Trim75	T	G	8: 64,982,547	Y417S	probably damaging	Het
Ttll12	T	C	15: 83,580,120	Y503C	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Unc5c	A	T	3: 141,816,931	Y706F	probably benign	Het
Zfp593	T	C	4: 134,244,766		probably benign	Het
Zfp956	T	C	6: 47,962,542	S175P	probably damaging	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACCCACTTTGCCTAAGC -3'
(R):5'- TGGAAACATGTTTCTCCCTTGC -3'

Sequencing Primer
(F):5'- TGAAAGAGTTGCTTGACCCC -3'
(R):5'- TTGGGTCCTGGGCCACAATG -3'

Posted On

2015-11-11