Incidental Mutation 'R4740:Syt6'
ID 359591
Institutional Source Beutler Lab
Gene Symbol Syt6
Ensembl Gene ENSMUSG00000027849
Gene Name synaptotagmin VI
Synonyms 3110037A08Rik
MMRRC Submission 041965-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # R4740 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 103482561-103552883 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 103532972 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 367 (M367R)
Ref Sequence ENSEMBL: ENSMUSP00000112486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000151985] [ENSMUST00000136049]
AlphaFold Q9R0N8
Predicted Effect probably damaging
Transcript: ENSMUST00000090697
AA Change: M452R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: M452R

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117221
AA Change: M367R

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849
AA Change: M367R

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118117
AA Change: M367R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849
AA Change: M367R

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118563
SMART Domains Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
Pfam:C2 294 332 3.5e-2 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121834
AA Change: M452R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: M452R

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132325
SMART Domains Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151985
Predicted Effect probably benign
Transcript: ENSMUST00000136049
SMART Domains Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Meta Mutation Damage Score 0.6708 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik C T 16: 21,513,146 (GRCm39) A4T probably benign Het
Aacs T C 5: 125,583,316 (GRCm39) S291P probably damaging Het
Abcb1a T C 5: 8,752,280 (GRCm39) probably null Het
Apol10a C T 15: 77,372,841 (GRCm39) T159I possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Atg16l2 A G 7: 100,946,385 (GRCm39) L129P probably damaging Het
Baiap2l2 T A 15: 79,143,951 (GRCm39) Y381F probably benign Het
Chd6 A T 2: 160,812,103 (GRCm39) D1363E probably benign Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cir1 T C 2: 73,142,867 (GRCm39) probably benign Het
Clec4a2 T C 6: 123,117,622 (GRCm39) I180T probably damaging Het
Clec4d T A 6: 123,245,072 (GRCm39) H117Q probably damaging Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Coro6 A G 11: 77,360,025 (GRCm39) E362G possibly damaging Het
Ctr9 T A 7: 110,634,578 (GRCm39) C196S probably benign Het
Cyp2c55 A G 19: 39,007,173 (GRCm39) K190E probably benign Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Dnah11 A G 12: 118,084,279 (GRCm39) F1242L probably benign Het
Dnah2 A G 11: 69,348,868 (GRCm39) W2534R probably damaging Het
Dph7 T C 2: 24,853,143 (GRCm39) S86P possibly damaging Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Eif4g3 T A 4: 137,925,408 (GRCm39) S1584T probably benign Het
Eml4 T G 17: 83,717,459 (GRCm39) D10E probably damaging Het
Enpp1 A T 10: 24,555,146 (GRCm39) C67S probably null Het
Epn1 A G 7: 5,093,012 (GRCm39) D108G probably damaging Het
Eps15 A G 4: 109,200,387 (GRCm39) Y2C probably damaging Het
Fam135b C T 15: 71,335,920 (GRCm39) V425I probably benign Het
Frem2 G A 3: 53,443,240 (GRCm39) A2508V probably benign Het
Fzd3 T A 14: 65,473,193 (GRCm39) M192L possibly damaging Het
Gls C T 1: 52,271,947 (GRCm39) A69T probably damaging Het
Gm10051 T A 5: 133,504,113 (GRCm39) noncoding transcript Het
Gm9271 A G 7: 39,013,346 (GRCm39) noncoding transcript Het
Gramd1b T C 9: 40,227,128 (GRCm39) probably null Het
Gvin-ps6 G A 7: 106,022,782 (GRCm39) noncoding transcript Het
H2-T23 A T 17: 36,343,016 (GRCm39) probably benign Het
H2-T5 T A 17: 36,478,448 (GRCm39) I195F probably damaging Het
Hmbox1 G A 14: 65,134,483 (GRCm39) T39I probably damaging Het
Hmx1 A G 5: 35,549,115 (GRCm39) E136G probably damaging Het
Hpdl T C 4: 116,678,221 (GRCm39) N80S probably damaging Het
Hydin A G 8: 111,173,071 (GRCm39) N918S probably benign Het
Igkv5-37 T A 6: 69,940,306 (GRCm39) S113C probably damaging Het
Il36rn T C 2: 24,167,503 (GRCm39) probably benign Het
Mab21l4 A C 1: 93,083,890 (GRCm39) M189R probably benign Het
Marco G T 1: 120,422,499 (GRCm39) T61K probably damaging Het
Med1 T A 11: 98,071,090 (GRCm39) R86* probably null Het
Mertk A G 2: 128,593,914 (GRCm39) Y306C probably damaging Het
Mgat4c T C 10: 102,224,265 (GRCm39) F160L probably damaging Het
Midn A T 10: 79,987,238 (GRCm39) E88V probably null Het
Muc4 G A 16: 32,596,277 (GRCm39) R3163H possibly damaging Het
Naip1 T C 13: 100,581,034 (GRCm39) D71G possibly damaging Het
Nhlrc4 T C 17: 26,162,577 (GRCm39) T57A probably benign Het
Nlrp1a T C 11: 71,004,466 (GRCm39) probably null Het
Npffr2 A T 5: 89,730,879 (GRCm39) K270* probably null Het
Or10a3 T G 7: 108,480,689 (GRCm39) E41D probably benign Het
Or2b6 T A 13: 21,823,340 (GRCm39) M118L possibly damaging Het
Or51e1 T A 7: 102,359,378 (GRCm39) I304N probably damaging Het
Or8g26 T A 9: 39,095,664 (GRCm39) Y60* probably null Het
Or8k40 C T 2: 86,584,155 (GRCm39) C309Y probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pabpc4l C G 3: 46,400,570 (GRCm39) G358A possibly damaging Het
Pabpc4l C T 3: 46,400,579 (GRCm39) R355H probably benign Het
Parp1 T C 1: 180,417,033 (GRCm39) S606P probably damaging Het
Pkhd1 A G 1: 20,594,354 (GRCm39) V1253A probably benign Het
Psg29 G A 7: 16,942,458 (GRCm39) R153H probably benign Het
Rbm25 A G 12: 83,691,181 (GRCm39) M58V possibly damaging Het
Rbm28 T C 6: 29,125,353 (GRCm39) probably benign Het
Ryr2 A G 13: 11,671,933 (GRCm39) S3436P possibly damaging Het
Slc3a1 A G 17: 85,354,181 (GRCm39) I335V probably benign Het
Slc4a4 T C 5: 89,373,753 (GRCm39) F953S probably damaging Het
Spata20 A G 11: 94,375,404 (GRCm39) I130T possibly damaging Het
Spata31h1 T C 10: 82,119,481 (GRCm39) T4510A possibly damaging Het
Srcap T C 7: 127,148,471 (GRCm39) S1879P probably damaging Het
St18 G C 1: 6,887,828 (GRCm39) V466L probably benign Het
Stard3nl A T 13: 19,551,948 (GRCm39) M166K probably benign Het
Stard3nl G A 13: 19,560,736 (GRCm39) T13M probably damaging Het
Stil A G 4: 114,863,979 (GRCm39) T74A probably benign Het
Tacc1 T C 8: 25,672,581 (GRCm39) T125A possibly damaging Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tcaf1 A G 6: 42,663,809 (GRCm39) S24P probably benign Het
Trim75 T G 8: 65,435,199 (GRCm39) Y417S probably damaging Het
Ttll12 T C 15: 83,464,321 (GRCm39) Y503C probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Unc5c A T 3: 141,522,692 (GRCm39) Y706F probably benign Het
Zfp593 T C 4: 133,972,077 (GRCm39) probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Syt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Syt6 APN 3 103,532,942 (GRCm39) missense probably damaging 0.98
IGL02944:Syt6 APN 3 103,482,865 (GRCm39) unclassified probably benign
IGL03168:Syt6 APN 3 103,494,943 (GRCm39) missense probably damaging 1.00
PIT4305001:Syt6 UTSW 3 103,482,769 (GRCm39) missense possibly damaging 0.91
R0124:Syt6 UTSW 3 103,494,842 (GRCm39) missense probably damaging 1.00
R0587:Syt6 UTSW 3 103,532,887 (GRCm39) missense probably damaging 0.99
R0601:Syt6 UTSW 3 103,528,206 (GRCm39) missense probably damaging 1.00
R1262:Syt6 UTSW 3 103,492,656 (GRCm39) critical splice acceptor site probably null
R1970:Syt6 UTSW 3 103,494,736 (GRCm39) missense probably benign 0.21
R4012:Syt6 UTSW 3 103,532,809 (GRCm39) splice site probably benign
R4450:Syt6 UTSW 3 103,492,961 (GRCm39) missense probably benign 0.01
R4493:Syt6 UTSW 3 103,492,946 (GRCm39) missense probably damaging 0.99
R4494:Syt6 UTSW 3 103,492,946 (GRCm39) missense probably damaging 0.99
R4495:Syt6 UTSW 3 103,494,876 (GRCm39) nonsense probably null
R4750:Syt6 UTSW 3 103,538,233 (GRCm39) makesense probably null
R5668:Syt6 UTSW 3 103,528,217 (GRCm39) missense probably damaging 1.00
R6185:Syt6 UTSW 3 103,492,844 (GRCm39) missense probably damaging 1.00
R6660:Syt6 UTSW 3 103,532,960 (GRCm39) missense probably damaging 1.00
R7120:Syt6 UTSW 3 103,494,673 (GRCm39) missense probably damaging 1.00
R7307:Syt6 UTSW 3 103,494,788 (GRCm39) missense probably damaging 1.00
R7501:Syt6 UTSW 3 103,495,018 (GRCm39) missense probably benign 0.01
R8768:Syt6 UTSW 3 103,492,850 (GRCm39) missense probably benign
R8867:Syt6 UTSW 3 103,534,371 (GRCm39) missense possibly damaging 0.91
R8885:Syt6 UTSW 3 103,532,941 (GRCm39) missense probably benign 0.06
R9068:Syt6 UTSW 3 103,494,825 (GRCm39) nonsense probably null
R9098:Syt6 UTSW 3 103,492,895 (GRCm39) missense probably damaging 0.96
R9361:Syt6 UTSW 3 103,482,679 (GRCm39) unclassified probably benign
Z1177:Syt6 UTSW 3 103,552,431 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCGACACAGATCCCTACGTC -3'
(R):5'- AAGATGGATGGCACTTGGTG -3'

Sequencing Primer
(F):5'- CAAAGTATCCCTACTGTGTGATGGAC -3'
(R):5'- AGCAGAATTACCCCAGGCTGG -3'
Posted On 2015-11-11