Incidental Mutation 'R4740:Enpp1'
ID 359628
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 1
Synonyms PC-1, E-NPP1, Npps, Pca, Pdnp1, CD203c, twy, NPP1, 4833416E15Rik, Pca-1, Ly-41
MMRRC Submission 041965-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.229) question?
Stock # R4740 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 24513812-24588057 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24555146 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 67 (C67S)
Ref Sequence ENSEMBL: ENSMUSP00000101159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039882
AA Change: C67S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370
AA Change: C67S

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105520
AA Change: C67S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: C67S

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135846
AA Change: C67S

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: C67S

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150570
Meta Mutation Damage Score 0.1325 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik C T 16: 21,513,146 (GRCm39) A4T probably benign Het
Aacs T C 5: 125,583,316 (GRCm39) S291P probably damaging Het
Abcb1a T C 5: 8,752,280 (GRCm39) probably null Het
Apol10a C T 15: 77,372,841 (GRCm39) T159I possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Atg16l2 A G 7: 100,946,385 (GRCm39) L129P probably damaging Het
Baiap2l2 T A 15: 79,143,951 (GRCm39) Y381F probably benign Het
Chd6 A T 2: 160,812,103 (GRCm39) D1363E probably benign Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cir1 T C 2: 73,142,867 (GRCm39) probably benign Het
Clec4a2 T C 6: 123,117,622 (GRCm39) I180T probably damaging Het
Clec4d T A 6: 123,245,072 (GRCm39) H117Q probably damaging Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Coro6 A G 11: 77,360,025 (GRCm39) E362G possibly damaging Het
Ctr9 T A 7: 110,634,578 (GRCm39) C196S probably benign Het
Cyp2c55 A G 19: 39,007,173 (GRCm39) K190E probably benign Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Dnah11 A G 12: 118,084,279 (GRCm39) F1242L probably benign Het
Dnah2 A G 11: 69,348,868 (GRCm39) W2534R probably damaging Het
Dph7 T C 2: 24,853,143 (GRCm39) S86P possibly damaging Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Eif4g3 T A 4: 137,925,408 (GRCm39) S1584T probably benign Het
Eml4 T G 17: 83,717,459 (GRCm39) D10E probably damaging Het
Epn1 A G 7: 5,093,012 (GRCm39) D108G probably damaging Het
Eps15 A G 4: 109,200,387 (GRCm39) Y2C probably damaging Het
Fam135b C T 15: 71,335,920 (GRCm39) V425I probably benign Het
Frem2 G A 3: 53,443,240 (GRCm39) A2508V probably benign Het
Fzd3 T A 14: 65,473,193 (GRCm39) M192L possibly damaging Het
Gls C T 1: 52,271,947 (GRCm39) A69T probably damaging Het
Gm10051 T A 5: 133,504,113 (GRCm39) noncoding transcript Het
Gm9271 A G 7: 39,013,346 (GRCm39) noncoding transcript Het
Gramd1b T C 9: 40,227,128 (GRCm39) probably null Het
Gvin-ps6 G A 7: 106,022,782 (GRCm39) noncoding transcript Het
H2-T23 A T 17: 36,343,016 (GRCm39) probably benign Het
H2-T5 T A 17: 36,478,448 (GRCm39) I195F probably damaging Het
Hmbox1 G A 14: 65,134,483 (GRCm39) T39I probably damaging Het
Hmx1 A G 5: 35,549,115 (GRCm39) E136G probably damaging Het
Hpdl T C 4: 116,678,221 (GRCm39) N80S probably damaging Het
Hydin A G 8: 111,173,071 (GRCm39) N918S probably benign Het
Igkv5-37 T A 6: 69,940,306 (GRCm39) S113C probably damaging Het
Il36rn T C 2: 24,167,503 (GRCm39) probably benign Het
Mab21l4 A C 1: 93,083,890 (GRCm39) M189R probably benign Het
Marco G T 1: 120,422,499 (GRCm39) T61K probably damaging Het
Med1 T A 11: 98,071,090 (GRCm39) R86* probably null Het
Mertk A G 2: 128,593,914 (GRCm39) Y306C probably damaging Het
Mgat4c T C 10: 102,224,265 (GRCm39) F160L probably damaging Het
Midn A T 10: 79,987,238 (GRCm39) E88V probably null Het
Muc4 G A 16: 32,596,277 (GRCm39) R3163H possibly damaging Het
Naip1 T C 13: 100,581,034 (GRCm39) D71G possibly damaging Het
Nhlrc4 T C 17: 26,162,577 (GRCm39) T57A probably benign Het
Nlrp1a T C 11: 71,004,466 (GRCm39) probably null Het
Npffr2 A T 5: 89,730,879 (GRCm39) K270* probably null Het
Or10a3 T G 7: 108,480,689 (GRCm39) E41D probably benign Het
Or2b6 T A 13: 21,823,340 (GRCm39) M118L possibly damaging Het
Or51e1 T A 7: 102,359,378 (GRCm39) I304N probably damaging Het
Or8g26 T A 9: 39,095,664 (GRCm39) Y60* probably null Het
Or8k40 C T 2: 86,584,155 (GRCm39) C309Y probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pabpc4l C G 3: 46,400,570 (GRCm39) G358A possibly damaging Het
Pabpc4l C T 3: 46,400,579 (GRCm39) R355H probably benign Het
Parp1 T C 1: 180,417,033 (GRCm39) S606P probably damaging Het
Pkhd1 A G 1: 20,594,354 (GRCm39) V1253A probably benign Het
Psg29 G A 7: 16,942,458 (GRCm39) R153H probably benign Het
Rbm25 A G 12: 83,691,181 (GRCm39) M58V possibly damaging Het
Rbm28 T C 6: 29,125,353 (GRCm39) probably benign Het
Ryr2 A G 13: 11,671,933 (GRCm39) S3436P possibly damaging Het
Slc3a1 A G 17: 85,354,181 (GRCm39) I335V probably benign Het
Slc4a4 T C 5: 89,373,753 (GRCm39) F953S probably damaging Het
Spata20 A G 11: 94,375,404 (GRCm39) I130T possibly damaging Het
Spata31h1 T C 10: 82,119,481 (GRCm39) T4510A possibly damaging Het
Srcap T C 7: 127,148,471 (GRCm39) S1879P probably damaging Het
St18 G C 1: 6,887,828 (GRCm39) V466L probably benign Het
Stard3nl A T 13: 19,551,948 (GRCm39) M166K probably benign Het
Stard3nl G A 13: 19,560,736 (GRCm39) T13M probably damaging Het
Stil A G 4: 114,863,979 (GRCm39) T74A probably benign Het
Syt6 T G 3: 103,532,972 (GRCm39) M367R probably damaging Het
Tacc1 T C 8: 25,672,581 (GRCm39) T125A possibly damaging Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tcaf1 A G 6: 42,663,809 (GRCm39) S24P probably benign Het
Trim75 T G 8: 65,435,199 (GRCm39) Y417S probably damaging Het
Ttll12 T C 15: 83,464,321 (GRCm39) Y503C probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Unc5c A T 3: 141,522,692 (GRCm39) Y706F probably benign Het
Zfp593 T C 4: 133,972,077 (GRCm39) probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24,521,325 (GRCm39) missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24,529,929 (GRCm39) missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24,540,512 (GRCm39) missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24,531,754 (GRCm39) missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24,517,859 (GRCm39) missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24,555,083 (GRCm39) splice site probably benign
IGL02691:Enpp1 APN 10 24,587,790 (GRCm39) missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24,536,172 (GRCm39) missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24,531,779 (GRCm39) splice site probably benign
IGL03330:Enpp1 APN 10 24,540,804 (GRCm39) splice site probably benign
IGL03365:Enpp1 APN 10 24,544,923 (GRCm39) missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24,536,181 (GRCm39) critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24,529,848 (GRCm39) missense probably benign 0.16
R0011:Enpp1 UTSW 10 24,545,900 (GRCm39) nonsense probably null
R0201:Enpp1 UTSW 10 24,529,815 (GRCm39) missense probably benign 0.00
R0496:Enpp1 UTSW 10 24,547,950 (GRCm39) missense probably benign 0.18
R1228:Enpp1 UTSW 10 24,521,310 (GRCm39) missense probably benign 0.30
R1536:Enpp1 UTSW 10 24,517,732 (GRCm39) missense probably benign 0.27
R1927:Enpp1 UTSW 10 24,530,786 (GRCm39) missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24,587,702 (GRCm39) critical splice donor site probably null
R2057:Enpp1 UTSW 10 24,536,090 (GRCm39) missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24,527,239 (GRCm39) missense probably benign 0.24
R4077:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4079:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4739:Enpp1 UTSW 10 24,555,146 (GRCm39) missense probably null 0.99
R4761:Enpp1 UTSW 10 24,517,849 (GRCm39) missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24,537,833 (GRCm39) missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24,523,983 (GRCm39) missense probably benign 0.01
R5140:Enpp1 UTSW 10 24,528,750 (GRCm39) missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24,527,288 (GRCm39) missense probably benign
R5421:Enpp1 UTSW 10 24,545,655 (GRCm39) missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24,530,806 (GRCm39) missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24,530,817 (GRCm39) missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24,523,137 (GRCm39) missense probably benign
R5942:Enpp1 UTSW 10 24,551,966 (GRCm39) nonsense probably null
R6048:Enpp1 UTSW 10 24,536,152 (GRCm39) missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24,533,024 (GRCm39) missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24,517,780 (GRCm39) missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24,523,929 (GRCm39) missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24,545,653 (GRCm39) nonsense probably null
R6793:Enpp1 UTSW 10 24,531,723 (GRCm39) missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24,527,237 (GRCm39) missense probably benign 0.30
R7255:Enpp1 UTSW 10 24,521,213 (GRCm39) missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24,536,059 (GRCm39) missense probably benign 0.01
R7401:Enpp1 UTSW 10 24,521,180 (GRCm39) missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7430:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7526:Enpp1 UTSW 10 24,550,308 (GRCm39) splice site probably null
R7532:Enpp1 UTSW 10 24,551,885 (GRCm39) missense probably benign 0.29
R7789:Enpp1 UTSW 10 24,529,981 (GRCm39) splice site probably null
R8073:Enpp1 UTSW 10 24,555,142 (GRCm39) missense possibly damaging 0.50
R8283:Enpp1 UTSW 10 24,550,554 (GRCm39) missense probably benign 0.25
R8955:Enpp1 UTSW 10 24,544,926 (GRCm39) missense probably benign 0.01
R9494:Enpp1 UTSW 10 24,527,234 (GRCm39) missense probably benign
Z1177:Enpp1 UTSW 10 24,537,840 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGAGTATGCACAGGACTTG -3'
(R):5'- TTTATCACCATCTCCAGAACAGG -3'

Sequencing Primer
(F):5'- CACAGGACTTGAAGATTACAGTTGTC -3'
(R):5'- AGAACAGGACATAAATCACAAGTATG -3'
Posted On 2015-11-11