Incidental Mutation 'R4740:Dnah2'
ID359633
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Namedynein, axonemal, heavy chain 2
SynonymsDnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik
MMRRC Submission 041965-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4740 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69420809-69549110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69458042 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 2534 (W2534R)
Ref Sequence ENSEMBL: ENSMUSP00000047329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
Predicted Effect probably damaging
Transcript: ENSMUST00000035539
AA Change: W2534R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: W2534R

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108659
AA Change: W2540R

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: W2540R

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124108
Meta Mutation Damage Score 0.6515 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A C 1: 93,156,168 M189R probably benign Het
2510009E07Rik C T 16: 21,694,396 A4T probably benign Het
4932415D10Rik T C 10: 82,283,647 T4510A possibly damaging Het
Aacs T C 5: 125,506,252 S291P probably damaging Het
Abcb1a T C 5: 8,702,280 probably null Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Baiap2l2 T A 15: 79,259,751 Y381F probably benign Het
Chd6 A T 2: 160,970,183 D1363E probably benign Het
Cir1 T C 2: 73,312,523 probably benign Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Clec4d T A 6: 123,268,113 H117Q probably damaging Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Coro6 A G 11: 77,469,199 E362G possibly damaging Het
Ctr9 T A 7: 111,035,371 C196S probably benign Het
Cyp2c55 A G 19: 39,018,729 K190E probably benign Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dnah11 A G 12: 118,120,544 F1242L probably benign Het
Dph7 T C 2: 24,963,131 S86P possibly damaging Het
Dpp9 A C 17: 56,198,970 probably null Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Eml4 T G 17: 83,410,030 D10E probably damaging Het
Enpp1 A T 10: 24,679,248 C67S probably null Het
Epn1 A G 7: 5,090,013 D108G probably damaging Het
Eps15 A G 4: 109,343,190 Y2C probably damaging Het
Fam135b C T 15: 71,464,071 V425I probably benign Het
Frem2 G A 3: 53,535,819 A2508V probably benign Het
Fzd3 T A 14: 65,235,744 M192L possibly damaging Het
Gls C T 1: 52,232,788 A69T probably damaging Het
Gm10051 T A 5: 133,475,274 noncoding transcript Het
Gm4759 G A 7: 106,423,575 noncoding transcript Het
Gm8909 T A 17: 36,167,556 I195F probably damaging Het
Gm9271 A G 7: 39,363,922 noncoding transcript Het
Gramd1b T C 9: 40,315,832 probably null Het
H2-T23 A T 17: 36,032,124 probably benign Het
Hmbox1 G A 14: 64,897,034 T39I probably damaging Het
Hmx1 A G 5: 35,391,771 E136G probably damaging Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A G 8: 110,446,439 N918S probably benign Het
Igkv5-37 T A 6: 69,963,322 S113C probably damaging Het
Il1f5 T C 2: 24,277,491 probably benign Het
Marco G T 1: 120,494,770 T61K probably damaging Het
Med1 T A 11: 98,180,264 R86* probably null Het
Mertk A G 2: 128,751,994 Y306C probably damaging Het
Mgat4c T C 10: 102,388,404 F160L probably damaging Het
Midn A T 10: 80,151,404 E88V probably null Het
Muc4 G A 16: 32,775,903 R3163H possibly damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nhlrc4 T C 17: 25,943,603 T57A probably benign Het
Nlrp1a T C 11: 71,113,640 probably null Het
Npffr2 A T 5: 89,583,020 K270* probably null Het
Olfr1090 C T 2: 86,753,811 C309Y probably benign Het
Olfr11 T A 13: 21,639,170 M118L possibly damaging Het
Olfr518 T G 7: 108,881,482 E41D probably benign Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Olfr943 T A 9: 39,184,368 Y60* probably null Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pabpc4l C G 3: 46,446,135 G358A possibly damaging Het
Pabpc4l C T 3: 46,446,144 R355H probably benign Het
Parp1 T C 1: 180,589,468 S606P probably damaging Het
Pkhd1 A G 1: 20,524,130 V1253A probably benign Het
Psg29 G A 7: 17,208,533 R153H probably benign Het
Rbm25 A G 12: 83,644,407 M58V possibly damaging Het
Rbm28 T C 6: 29,125,354 probably benign Het
Ryr2 A G 13: 11,657,047 S3436P possibly damaging Het
Slc3a1 A G 17: 85,046,753 I335V probably benign Het
Slc4a4 T C 5: 89,225,894 F953S probably damaging Het
Spata20 A G 11: 94,484,578 I130T possibly damaging Het
Srcap T C 7: 127,549,299 S1879P probably damaging Het
St18 G C 1: 6,817,604 V466L probably benign Het
Stard3nl A T 13: 19,367,778 M166K probably benign Het
Stard3nl G A 13: 19,376,566 T13M probably damaging Het
Stil A G 4: 115,006,782 T74A probably benign Het
Syt6 T G 3: 103,625,656 M367R probably damaging Het
Tacc1 T C 8: 25,182,565 T125A possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tcaf1 A G 6: 42,686,875 S24P probably benign Het
Trim75 T G 8: 64,982,547 Y417S probably damaging Het
Ttll12 T C 15: 83,580,120 Y503C probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Unc5c A T 3: 141,816,931 Y706F probably benign Het
Zfp593 T C 4: 134,244,766 probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69492672 missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69495066 splice site probably benign
IGL00772:Dnah2 APN 11 69451257 missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69473350 critical splice donor site probably null
IGL00827:Dnah2 APN 11 69448457 missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69478092 missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69493184 missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69475606 missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69432964 missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69474191 splice site probably benign
IGL01480:Dnah2 APN 11 69458371 missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69516080 missense probably benign 0.17
IGL01592:Dnah2 APN 11 69431087 missense probably benign 0.14
IGL01612:Dnah2 APN 11 69465063 splice site probably benign
IGL01667:Dnah2 APN 11 69544395 missense probably benign
IGL01667:Dnah2 APN 11 69520941 missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69539443 missense probably benign
IGL02019:Dnah2 APN 11 69474285 missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69499212 missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69422559 missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69458185 missense probably benign 0.07
IGL02158:Dnah2 APN 11 69458123 missense probably benign
IGL02381:Dnah2 APN 11 69446292 missense probably benign 0.25
IGL02681:Dnah2 APN 11 69452933 missense probably benign 0.40
IGL02957:Dnah2 APN 11 69448507 missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69518414 missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69521187 missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69436291 splice site probably benign
IGL03120:Dnah2 APN 11 69421848 missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69458488 missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69459263 missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69529381 critical splice donor site probably null
IGL03333:Dnah2 APN 11 69495123 missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69496577 missense probably benign 0.13
argyrios UTSW 11 69516590 missense possibly damaging 0.47
Aureus UTSW 11 69429348 missense probably damaging 1.00
platinum UTSW 11 69458042 missense probably damaging 0.96
R0334_dnah2_144 UTSW 11 69436836 missense probably damaging 1.00
R2150_dnah2_212 UTSW 11 69515761 missense probably benign 0.14
BB005:Dnah2 UTSW 11 69430835 missense probably damaging 0.98
BB015:Dnah2 UTSW 11 69430835 missense probably damaging 0.98
E0370:Dnah2 UTSW 11 69515615 splice site probably null
P0026:Dnah2 UTSW 11 69464947 missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69421009 missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69435249 missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69436836 missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69529531 missense probably benign 0.00
R0386:Dnah2 UTSW 11 69447861 missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69499238 missense probably benign 0.26
R0427:Dnah2 UTSW 11 69452879 missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69459288 missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69448542 missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69459201 missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69423126 missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69499194 missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69477683 missense probably benign 0.07
R0924:Dnah2 UTSW 11 69421308 missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69448519 missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69447819 missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69446648 missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69499190 missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69515700 missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69451050 missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69520667 splice site probably null
R1538:Dnah2 UTSW 11 69477202 missense probably benign 0.17
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1590:Dnah2 UTSW 11 69422754 critical splice donor site probably null
R1590:Dnah2 UTSW 11 69521198 missense probably benign 0.00
R1655:Dnah2 UTSW 11 69473854 missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69514691 missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69497889 missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69423543 missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69475574 missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69514804 missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69437886 missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69515752 missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69464930 missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69474325 missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69458358 critical splice donor site probably null
R2016:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69524240 missense probably benign 0.14
R2077:Dnah2 UTSW 11 69496606 missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69455916 missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69493237 missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2128:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2146:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2147:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2150:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2404:Dnah2 UTSW 11 69437221 missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69524206 nonsense probably null
R2517:Dnah2 UTSW 11 69516644 missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69430478 missense probably benign
R3741:Dnah2 UTSW 11 69448469 missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69492650 splice site probably null
R3872:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69451347 missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69454103 missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69484021 missense probably benign 0.00
R4501:Dnah2 UTSW 11 69477659 missense probably benign
R4515:Dnah2 UTSW 11 69465631 missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69483367 missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69463661 missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69465376 missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69496559 missense probably benign 0.00
R4683:Dnah2 UTSW 11 69458942 missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69498532 missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69478077 missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69516590 missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69476688 missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69429357 missense probably benign 0.00
R4780:Dnah2 UTSW 11 69473871 missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69423205 missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69422590 missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69463648 missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69476691 missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69521147 missense probably benign 0.00
R4911:Dnah2 UTSW 11 69499104 critical splice donor site probably null
R4954:Dnah2 UTSW 11 69539496 missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69455973 nonsense probably null
R5015:Dnah2 UTSW 11 69497882 missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69448166 missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69520773 missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69520933 missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69422536 missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69435884 missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5208:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5252:Dnah2 UTSW 11 69529469 missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5298:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5299:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5301:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5324:Dnah2 UTSW 11 69457993 missense probably benign 0.07
R5350:Dnah2 UTSW 11 69516036 missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69421848 missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69500857 missense probably benign
R5421:Dnah2 UTSW 11 69435636 missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69524383 missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69473351 critical splice donor site probably null
R5474:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5476:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5477:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5510:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5527:Dnah2 UTSW 11 69437188 nonsense probably null
R5566:Dnah2 UTSW 11 69516569 nonsense probably null
R5587:Dnah2 UTSW 11 69437242 missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5688:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5690:Dnah2 UTSW 11 69491544 missense probably benign 0.15
R5711:Dnah2 UTSW 11 69435390 missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69430817 missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5913:Dnah2 UTSW 11 69448430 missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5960:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5961:Dnah2 UTSW 11 69431148 missense probably damaging 1.00
R5961:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5977:Dnah2 UTSW 11 69520881 missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69500839 missense probably benign
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6050:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6086:Dnah2 UTSW 11 69516008 missense probably benign 0.30
R6115:Dnah2 UTSW 11 69446649 missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69518359 missense probably benign 0.29
R6159:Dnah2 UTSW 11 69458542 missense probably damaging 1.00
R6159:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6163:Dnah2 UTSW 11 69520903 nonsense probably null
R6171:Dnah2 UTSW 11 69423042 missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69457412 missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69491641 missense probably benign 0.25
R6352:Dnah2 UTSW 11 69448227 missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69458518 missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69539415 missense probably benign
R6478:Dnah2 UTSW 11 69516010 missense probably benign 0.01
R6516:Dnah2 UTSW 11 69465386 missense probably benign 0.34
R6538:Dnah2 UTSW 11 69437197 missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69423690 missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69455963 missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69429471 missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69484260 missense probably benign 0.12
R6935:Dnah2 UTSW 11 69421741 missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69491547 nonsense probably null
R7073:Dnah2 UTSW 11 69430492 nonsense probably null
R7111:Dnah2 UTSW 11 69446753 splice site probably null
R7125:Dnah2 UTSW 11 69436182 missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69491555 missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69549097 splice site probably null
R7214:Dnah2 UTSW 11 69431109 missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69421396 missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69459146 critical splice donor site probably null
R7256:Dnah2 UTSW 11 69431094 missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69500817 missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69478797 missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69492805 missense probably benign 0.25
R7437:Dnah2 UTSW 11 69498627 missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7473:Dnah2 UTSW 11 69491658 missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69500796 missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7615:Dnah2 UTSW 11 69435304 missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69498685 missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69451318 nonsense probably null
R7764:Dnah2 UTSW 11 69458158 missense probably benign 0.29
R7793:Dnah2 UTSW 11 69495214 missense probably benign 0.00
R7819:Dnah2 UTSW 11 69516593 missense probably benign 0.01
R7881:Dnah2 UTSW 11 69431238 missense probably damaging 1.00
R7900:Dnah2 UTSW 11 69518428 missense probably damaging 1.00
R7916:Dnah2 UTSW 11 69421148 critical splice acceptor site probably null
R7921:Dnah2 UTSW 11 69520834 missense probably benign
R7928:Dnah2 UTSW 11 69430835 missense probably damaging 0.98
R7937:Dnah2 UTSW 11 69517685 nonsense probably null
R7995:Dnah2 UTSW 11 69520737 missense possibly damaging 0.77
R8202:Dnah2 UTSW 11 69478823 missense probably benign 0.00
R8208:Dnah2 UTSW 11 69520852 missense probably benign 0.05
R8215:Dnah2 UTSW 11 69435367 missense probably damaging 1.00
R8279:Dnah2 UTSW 11 69475573 missense probably damaging 1.00
R8338:Dnah2 UTSW 11 69487296 missense probably damaging 1.00
R8348:Dnah2 UTSW 11 69429447 missense possibly damaging 0.95
R8405:Dnah2 UTSW 11 69458463 missense probably damaging 1.00
R8407:Dnah2 UTSW 11 69459278 missense probably benign 0.00
R8493:Dnah2 UTSW 11 69452978 missense probably damaging 1.00
R8673:Dnah2 UTSW 11 69514697 missense probably benign 0.23
R8725:Dnah2 UTSW 11 69524179 missense probably damaging 1.00
R8727:Dnah2 UTSW 11 69524179 missense probably damaging 1.00
R8730:Dnah2 UTSW 11 69493261 missense possibly damaging 0.73
R8804:Dnah2 UTSW 11 69465685 missense probably benign 0.01
R8876:Dnah2 UTSW 11 69491522 missense probably damaging 1.00
R8894:Dnah2 UTSW 11 69492222 missense probably benign 0.01
R8938:Dnah2 UTSW 11 69437928 missense probably damaging 0.99
R9044:Dnah2 UTSW 11 69529421 missense probably benign
RF004:Dnah2 UTSW 11 69437187 missense probably benign 0.24
U24488:Dnah2 UTSW 11 69483822 missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69448562 missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69430793 missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69421821 missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69451120 missense probably benign
Z1176:Dnah2 UTSW 11 69487054 missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69498667 missense probably benign 0.12
Z1176:Dnah2 UTSW 11 69516481 missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69516523 missense probably damaging 1.00
Z1177:Dnah2 UTSW 11 69463453 missense possibly damaging 0.63
Z1177:Dnah2 UTSW 11 69544557 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGTTAAGGATGGGGTCAGTAACTTG -3'
(R):5'- TGTGTGCTTTCCCACCAGAC -3'

Sequencing Primer
(F):5'- GCCAGATAGATGGGTCCTCAG -3'
(R):5'- GACCACGTCAAACAATGTGCAGAG -3'
Posted On2015-11-11