Incidental Mutation 'R4740:Ttll12'
ID359652
Institutional Source Beutler Lab
Gene Symbol Ttll12
Ensembl Gene ENSMUSG00000016757
Gene Nametubulin tyrosine ligase-like family, member 12
Synonyms
MMRRC Submission 041965-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4740 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83575090-83595157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83580120 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 503 (Y503C)
Ref Sequence ENSEMBL: ENSMUSP00000016901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016901] [ENSMUST00000136066]
Predicted Effect probably damaging
Transcript: ENSMUST00000016901
AA Change: Y503C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016901
Gene: ENSMUSG00000016757
AA Change: Y503C

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
Pfam:TTL 341 637 7.4e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134334
Predicted Effect probably benign
Transcript: ENSMUST00000136066
SMART Domains Protein: ENSMUSP00000117161
Gene: ENSMUSG00000016757

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 66 79 N/A INTRINSIC
Meta Mutation Damage Score 0.5234 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (95/95)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A C 1: 93,156,168 M189R probably benign Het
2510009E07Rik C T 16: 21,694,396 A4T probably benign Het
4932415D10Rik T C 10: 82,283,647 T4510A possibly damaging Het
Aacs T C 5: 125,506,252 S291P probably damaging Het
Abcb1a T C 5: 8,702,280 probably null Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Baiap2l2 T A 15: 79,259,751 Y381F probably benign Het
Chd6 A T 2: 160,970,183 D1363E probably benign Het
Cir1 T C 2: 73,312,523 probably benign Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Clec4d T A 6: 123,268,113 H117Q probably damaging Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Coro6 A G 11: 77,469,199 E362G possibly damaging Het
Ctr9 T A 7: 111,035,371 C196S probably benign Het
Cyp2c55 A G 19: 39,018,729 K190E probably benign Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dnah11 A G 12: 118,120,544 F1242L probably benign Het
Dnah2 A G 11: 69,458,042 W2534R probably damaging Het
Dph7 T C 2: 24,963,131 S86P possibly damaging Het
Dpp9 A C 17: 56,198,970 probably null Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Eml4 T G 17: 83,410,030 D10E probably damaging Het
Enpp1 A T 10: 24,679,248 C67S probably null Het
Epn1 A G 7: 5,090,013 D108G probably damaging Het
Eps15 A G 4: 109,343,190 Y2C probably damaging Het
Fam135b C T 15: 71,464,071 V425I probably benign Het
Frem2 G A 3: 53,535,819 A2508V probably benign Het
Fzd3 T A 14: 65,235,744 M192L possibly damaging Het
Gls C T 1: 52,232,788 A69T probably damaging Het
Gm10051 T A 5: 133,475,274 noncoding transcript Het
Gm4759 G A 7: 106,423,575 noncoding transcript Het
Gm8909 T A 17: 36,167,556 I195F probably damaging Het
Gm9271 A G 7: 39,363,922 noncoding transcript Het
Gramd1b T C 9: 40,315,832 probably null Het
H2-T23 A T 17: 36,032,124 probably benign Het
Hmbox1 G A 14: 64,897,034 T39I probably damaging Het
Hmx1 A G 5: 35,391,771 E136G probably damaging Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A G 8: 110,446,439 N918S probably benign Het
Igkv5-37 T A 6: 69,963,322 S113C probably damaging Het
Il1f5 T C 2: 24,277,491 probably benign Het
Marco G T 1: 120,494,770 T61K probably damaging Het
Med1 T A 11: 98,180,264 R86* probably null Het
Mertk A G 2: 128,751,994 Y306C probably damaging Het
Mgat4c T C 10: 102,388,404 F160L probably damaging Het
Midn A T 10: 80,151,404 E88V probably null Het
Muc4 G A 16: 32,775,903 R3163H possibly damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nhlrc4 T C 17: 25,943,603 T57A probably benign Het
Nlrp1a T C 11: 71,113,640 probably null Het
Npffr2 A T 5: 89,583,020 K270* probably null Het
Olfr1090 C T 2: 86,753,811 C309Y probably benign Het
Olfr11 T A 13: 21,639,170 M118L possibly damaging Het
Olfr518 T G 7: 108,881,482 E41D probably benign Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Olfr943 T A 9: 39,184,368 Y60* probably null Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pabpc4l C G 3: 46,446,135 G358A possibly damaging Het
Pabpc4l C T 3: 46,446,144 R355H probably benign Het
Parp1 T C 1: 180,589,468 S606P probably damaging Het
Pkhd1 A G 1: 20,524,130 V1253A probably benign Het
Psg29 G A 7: 17,208,533 R153H probably benign Het
Rbm25 A G 12: 83,644,407 M58V possibly damaging Het
Rbm28 T C 6: 29,125,354 probably benign Het
Ryr2 A G 13: 11,657,047 S3436P possibly damaging Het
Slc3a1 A G 17: 85,046,753 I335V probably benign Het
Slc4a4 T C 5: 89,225,894 F953S probably damaging Het
Spata20 A G 11: 94,484,578 I130T possibly damaging Het
Srcap T C 7: 127,549,299 S1879P probably damaging Het
St18 G C 1: 6,817,604 V466L probably benign Het
Stard3nl A T 13: 19,367,778 M166K probably benign Het
Stard3nl G A 13: 19,376,566 T13M probably damaging Het
Stil A G 4: 115,006,782 T74A probably benign Het
Syt6 T G 3: 103,625,656 M367R probably damaging Het
Tacc1 T C 8: 25,182,565 T125A possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tcaf1 A G 6: 42,686,875 S24P probably benign Het
Trim75 T G 8: 64,982,547 Y417S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Unc5c A T 3: 141,816,931 Y706F probably benign Het
Zfp593 T C 4: 134,244,766 probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Ttll12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ttll12 APN 15 83578656 missense probably benign 0.15
IGL00942:Ttll12 APN 15 83582448 missense possibly damaging 0.65
IGL01746:Ttll12 APN 15 83578676 missense probably damaging 1.00
IGL02102:Ttll12 APN 15 83582063 missense probably damaging 1.00
IGL02475:Ttll12 APN 15 83587101 missense probably damaging 1.00
IGL02484:Ttll12 APN 15 83581696 missense possibly damaging 0.94
R0403:Ttll12 UTSW 15 83580658 splice site probably benign
R1477:Ttll12 UTSW 15 83580102 missense probably damaging 1.00
R1530:Ttll12 UTSW 15 83588655 missense probably damaging 1.00
R1925:Ttll12 UTSW 15 83581775 missense probably benign 0.06
R3508:Ttll12 UTSW 15 83580630 missense probably damaging 0.98
R3972:Ttll12 UTSW 15 83582096 missense probably damaging 1.00
R4198:Ttll12 UTSW 15 83577013 missense probably damaging 1.00
R4200:Ttll12 UTSW 15 83577013 missense probably damaging 1.00
R4357:Ttll12 UTSW 15 83581757 missense probably damaging 1.00
R5024:Ttll12 UTSW 15 83587113 missense probably damaging 1.00
R5870:Ttll12 UTSW 15 83577036 missense probably damaging 0.97
R6824:Ttll12 UTSW 15 83591377 critical splice donor site probably null
R7034:Ttll12 UTSW 15 83586885 missense probably benign
R7036:Ttll12 UTSW 15 83586885 missense probably benign
R7447:Ttll12 UTSW 15 83586975 missense probably damaging 1.00
R8496:Ttll12 UTSW 15 83577809 missense probably damaging 1.00
R8721:Ttll12 UTSW 15 83580583 missense probably damaging 1.00
Z1088:Ttll12 UTSW 15 83582078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCATGCAGATCTCACTG -3'
(R):5'- AGAGTATCTCCACAGTGCATCAC -3'

Sequencing Primer
(F):5'- GGCATGCAGATCTCACTGTACTC -3'
(R):5'- ACTTGTCTTCACTCGAAATTCAGG -3'
Posted On2015-11-11