Incidental Mutation 'R3909:Gbp3'
ID359662
Institutional Source Beutler Lab
Gene Symbol Gbp3
Ensembl Gene ENSMUSG00000028268
Gene Nameguanylate binding protein 3
Synonyms
MMRRC Submission 040814-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3909 (G1)
Quality Score24
Status Validated
Chromosome3
Chromosomal Location142560026-142573209 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 142566338 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029935] [ENSMUST00000106221] [ENSMUST00000106222] [ENSMUST00000128609] [ENSMUST00000142060] [ENSMUST00000199325]
Predicted Effect probably benign
Transcript: ENSMUST00000029935
SMART Domains Protein: ENSMUSP00000029935
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 275 7.2e-126 PFAM
Pfam:GBP_C 277 573 2.6e-126 PFAM
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106221
SMART Domains Protein: ENSMUSP00000101828
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 275 7.2e-126 PFAM
Pfam:GBP_C 277 573 2.6e-126 PFAM
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106222
SMART Domains Protein: ENSMUSP00000101829
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 275 9.6e-125 PFAM
Pfam:GBP_C 277 573 2.6e-126 PFAM
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128609
SMART Domains Protein: ENSMUSP00000117991
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 83 1.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142060
SMART Domains Protein: ENSMUSP00000120131
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 136 4.8e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142731
Predicted Effect probably benign
Transcript: ENSMUST00000199325
SMART Domains Protein: ENSMUSP00000142411
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 57 8.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylate-binding proteins, such as GBP4, are induced by interferon and hydrolyze GTP to both GDP and GMP (Vestal, 2005 [PubMed 16108726]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,648,166 F501Y probably damaging Het
Alk T C 17: 71,897,911 T1089A probably benign Het
Ankrd12 G T 17: 65,984,005 P1478T probably benign Het
Arhgap39 A G 15: 76,751,888 V49A probably benign Het
Arid4b T C 13: 14,132,484 L108P probably damaging Het
Atrn T A 2: 130,994,207 C1136S probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Casp8 T C 1: 58,844,811 S446P probably damaging Het
Cngb3 G A 4: 19,461,679 C520Y probably damaging Het
Crim1 C T 17: 78,281,239 probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fbxl17 G A 17: 63,499,807 P71S possibly damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Golga4 A G 9: 118,558,736 D1642G possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Hyls1 T C 9: 35,561,409 D237G probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Muc5b C T 7: 141,849,498 T732M unknown Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Olfr1143 T A 2: 87,802,687 F95L probably benign Het
Olfr1153 T A 2: 87,896,949 probably null Het
Olfr1251 T C 2: 89,667,013 E291G probably damaging Het
Olfr304 T A 7: 86,385,974 T229S probably benign Het
Prps1l1 A T 12: 34,985,798 H304L possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Rlf G A 4: 121,149,032 T917I probably benign Het
Ryr3 T C 2: 112,636,608 D4704G probably damaging Het
Scn1a T A 2: 66,273,988 I1643F probably damaging Het
Vmn2r38 T C 7: 9,075,554 K610E probably damaging Het
Zfc3h1 T C 10: 115,419,901 F1486L probably benign Het
Other mutations in Gbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Gbp3 APN 3 142565244 unclassified probably benign
IGL01067:Gbp3 APN 3 142566597 splice site probably null
IGL02965:Gbp3 APN 3 142567582 missense probably benign 0.31
R0136:Gbp3 UTSW 3 142564101 splice site probably null
R0609:Gbp3 UTSW 3 142567772 missense probably damaging 0.99
R0671:Gbp3 UTSW 3 142565390 missense probably benign 0.17
R0673:Gbp3 UTSW 3 142565254 missense probably benign 0.45
R0786:Gbp3 UTSW 3 142570971 missense possibly damaging 0.67
R2511:Gbp3 UTSW 3 142570582 missense probably benign 0.31
R3912:Gbp3 UTSW 3 142566338 unclassified probably benign
R4816:Gbp3 UTSW 3 142567574 missense probably damaging 0.99
R5822:Gbp3 UTSW 3 142566478 missense probably benign 0.01
R6046:Gbp3 UTSW 3 142567799 missense possibly damaging 0.81
R6328:Gbp3 UTSW 3 142569058 missense probably benign 0.01
R7186:Gbp3 UTSW 3 142564162 missense probably damaging 0.97
R7536:Gbp3 UTSW 3 142566395 missense probably damaging 1.00
R7543:Gbp3 UTSW 3 142566580 missense probably damaging 0.97
R7602:Gbp3 UTSW 3 142569061 missense probably benign 0.00
R7677:Gbp3 UTSW 3 142560503 start gained probably benign
R7764:Gbp3 UTSW 3 142565263 missense probably benign 0.37
R7923:Gbp3 UTSW 3 142567612 missense probably damaging 1.00
X0025:Gbp3 UTSW 3 142566432 missense probably benign 0.42
X0062:Gbp3 UTSW 3 142561774 missense probably damaging 1.00
Z1176:Gbp3 UTSW 3 142561863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACTAAGCACTGAGGTCTC -3'
(R):5'- CTCAGAGTCTTGGTCTTGCC -3'

Sequencing Primer
(F):5'- TAAGCACTGAGGTCTCCCAATG -3'
(R):5'- TTTCTGATTCAACCTGGAAATTCCG -3'
Posted On2015-11-12