Incidental Mutation 'R3839:Sec14l3'
ID359665
Institutional Source Beutler Lab
Gene Symbol Sec14l3
Ensembl Gene ENSMUSG00000054986
Gene NameSEC14-like lipid binding 3
Synonyms
MMRRC Submission 040892-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R3839 (G1)
Quality Score33
Status Validated
Chromosome11
Chromosomal Location4064841-4077736 bp(+) (GRCm38)
Type of Mutationintron (49 bp from exon)
DNA Base Change (assembly) A to G at 4071544 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000065084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068322]
Predicted Effect probably null
Transcript: ENSMUST00000068322
SMART Domains Protein: ENSMUSP00000065084
Gene: ENSMUSG00000054986

DomainStartEndE-ValueType
CRAL_TRIO_N 34 59 2.71e-7 SMART
SEC14 76 247 1.18e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129330
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the protein encoded by the Saccharomyces cerevisiae SEC14 gene. The SEC14 protein is a phophatidylinositol transfer protein that is essential for biogenesis of Golgi-derived transport vesicles, and thus is required for the export of yeast secretory proteins from the Golgi complex. The specific function of this protein has not yet been determined. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Abraxas2 T A 7: 132,883,138 S303R probably benign Het
Ackr3 G A 1: 90,214,128 S103N probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cald1 A T 6: 34,745,765 D122V probably damaging Het
Cc2d2a T C 5: 43,718,714 V1011A probably benign Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Cmbl T C 15: 31,581,998 V47A probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctnnd2 T A 15: 31,009,028 probably null Het
Cyp4a10 A C 4: 115,525,347 E278A possibly damaging Het
Ddx56 T C 11: 6,267,712 D3G probably benign Het
Dnajb2 G A 1: 75,241,480 probably null Het
Eif3d T A 15: 77,964,100 T211S probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Garnl3 C T 2: 32,989,546 G923S probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gpr156 T A 16: 37,988,600 V228D probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itga3 A G 11: 95,057,269 probably null Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Klhl40 A G 9: 121,780,416 Y453C possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Rala A T 13: 17,893,174 C91S probably damaging Het
Rps9 A G 7: 3,706,824 probably benign Het
Sdr16c5 C A 4: 4,006,601 M230I probably damaging Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Skor1 A C 9: 63,144,448 S746R probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Slc47a1 G T 11: 61,353,058 probably benign Het
Slit3 A T 11: 35,508,237 N143I probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r109 A G 17: 20,554,442 V217A probably damaging Het
Zfp108 A G 7: 24,260,556 I191V probably benign Het
Other mutations in Sec14l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Sec14l3 APN 11 4076238 splice site probably benign
IGL01382:Sec14l3 APN 11 4068104 missense probably damaging 0.98
IGL02304:Sec14l3 APN 11 4074768 missense probably damaging 1.00
IGL02565:Sec14l3 APN 11 4076237 splice site probably benign
IGL02836:Sec14l3 APN 11 4070084 missense probably benign 0.02
R0183:Sec14l3 UTSW 11 4075547 missense probably benign 0.03
R0597:Sec14l3 UTSW 11 4074814 missense probably damaging 1.00
R1425:Sec14l3 UTSW 11 4066487 missense probably damaging 1.00
R1834:Sec14l3 UTSW 11 4066510 splice site probably benign
R2090:Sec14l3 UTSW 11 4075481 missense probably benign 0.00
R4424:Sec14l3 UTSW 11 4066210 missense probably damaging 1.00
R4948:Sec14l3 UTSW 11 4068101 missense possibly damaging 0.75
R5124:Sec14l3 UTSW 11 4075209 missense possibly damaging 0.67
R5588:Sec14l3 UTSW 11 4066138 missense probably damaging 1.00
R5635:Sec14l3 UTSW 11 4071484 missense probably damaging 1.00
R6185:Sec14l3 UTSW 11 4075244 missense probably damaging 1.00
R6192:Sec14l3 UTSW 11 4075566 splice site probably null
R6699:Sec14l3 UTSW 11 4075193 missense possibly damaging 0.78
R7002:Sec14l3 UTSW 11 4075263 missense possibly damaging 0.87
R7351:Sec14l3 UTSW 11 4074785 missense probably benign 0.00
R7357:Sec14l3 UTSW 11 4070127 missense probably benign 0.03
R7845:Sec14l3 UTSW 11 4067972 missense probably benign 0.38
R7890:Sec14l3 UTSW 11 4074795 missense probably damaging 0.96
R8108:Sec14l3 UTSW 11 4066198 missense probably damaging 1.00
RF011:Sec14l3 UTSW 11 4067963 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CATTGTGGAAATGTGGCCCAG -3'
(R):5'- GCCTTACTCTACAGCTTAGGTG -3'

Sequencing Primer
(F):5'- AGTGGCTTGATCTCTCCCTG -3'
(R):5'- ACTCTACAGCTTAGGTGTGAAGC -3'
Posted On2015-11-12