Incidental Mutation 'R3828:Gm5862'
ID359667
Institutional Source Beutler Lab
Gene Symbol Gm5862
Ensembl Gene ENSMUSG00000067700
Gene Namepredicted gene 5862
Synonyms
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R3828 (G1)
Quality Score30
Status Validated
Chromosome5
Chromosomal Location26017278-26022916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 26019347 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 208 (H208P)
Ref Sequence ENSEMBL: ENSMUSP00000072133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072286]
Predicted Effect probably benign
Transcript: ENSMUST00000072286
AA Change: H208P

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072133
Gene: ENSMUSG00000067700
AA Change: H208P

DomainStartEndE-ValueType
Pfam:Takusan 50 134 1.6e-25 PFAM
low complexity region 154 168 N/A INTRINSIC
low complexity region 235 259 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Gm5862
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Gm5862 APN 5 26019516 missense probably benign
IGL01863:Gm5862 APN 5 26022771 missense probably benign
IGL01868:Gm5862 APN 5 26022771 missense probably benign
IGL01873:Gm5862 APN 5 26022771 missense probably benign
IGL01881:Gm5862 APN 5 26022771 missense probably benign
IGL01902:Gm5862 APN 5 26022771 missense probably benign
IGL01905:Gm5862 APN 5 26022771 missense probably benign
IGL01909:Gm5862 APN 5 26022771 missense probably benign
IGL01917:Gm5862 APN 5 26022771 missense probably benign
IGL01924:Gm5862 APN 5 26022771 missense probably benign
IGL01927:Gm5862 APN 5 26022771 missense probably benign
IGL01951:Gm5862 APN 5 26022771 missense probably benign
IGL03374:Gm5862 APN 5 26019512 missense probably damaging 0.98
R2475:Gm5862 UTSW 5 26019492 missense probably damaging 1.00
R4591:Gm5862 UTSW 5 26019488 missense possibly damaging 0.95
R6916:Gm5862 UTSW 5 26019348 missense probably benign
R8291:Gm5862 UTSW 5 26019446 missense probably benign 0.32
Z1176:Gm5862 UTSW 5 26018487 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTAATTCAGAGTCTCACAAGAGG -3'
(R):5'- ACCATGCAGAGTGTGTTTCC -3'

Sequencing Primer
(F):5'- GAGTCTCACAAGAGGTTGACTTCC -3'
(R):5'- CCATGCAGAGTGTGTTTCCAGTAAC -3'
Posted On2015-11-13