Incidental Mutation 'R3772:Abcb11'
ID359670
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
MMRRC Submission 040748-MU
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R3772 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 69329376 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
Predicted Effect probably benign
Transcript: ENSMUST00000102709
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102710
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117306
Predicted Effect probably benign
Transcript: ENSMUST00000180142
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Meta Mutation Damage Score 0.1004 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Adgrl1 A G 8: 83,923,004 N97S possibly damaging Het
Aldh1a2 A G 9: 71,252,920 D76G probably damaging Het
Aldh3a1 A G 11: 61,214,605 E179G possibly damaging Het
Ap1g1 A G 8: 109,837,786 D324G probably damaging Het
Arfgap2 A G 2: 91,265,366 T12A probably benign Het
Aurka A G 2: 172,366,960 L85P probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Bmp7 A T 2: 172,870,222 I403N probably damaging Het
Carns1 A G 19: 4,170,916 probably benign Het
Ccdc88c G A 12: 100,966,100 probably benign Het
Ccl2 C T 11: 82,036,958 A76V probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Col24a1 T C 3: 145,545,286 L1680P probably damaging Het
Col4a6 C A X: 141,172,200 G1416C probably damaging Het
Ctnna2 T G 6: 76,973,769 N573T probably damaging Het
Cts8 G A 13: 61,250,901 probably benign Het
Cxcl17 A G 7: 25,400,329 probably benign Het
Defb18 T C 1: 18,236,621 H37R possibly damaging Het
Dis3l2 T C 1: 86,854,408 I229T probably benign Het
Dysf G A 6: 84,152,351 S1474N possibly damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
F13a1 T C 13: 36,898,134 K532R probably benign Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Focad A C 4: 88,336,161 probably benign Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Frrs1 T G 3: 116,878,387 S45A possibly damaging Het
Gm5422 T A 10: 31,248,514 noncoding transcript Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Iglon5 A T 7: 43,480,613 Y42* probably null Het
Khdrbs2 C T 1: 32,244,076 Q90* probably null Het
Krt74 T C 15: 101,762,195 noncoding transcript Het
Lamc2 T A 1: 153,124,251 M1121L probably benign Het
Lrig1 A G 6: 94,605,817 L1073P probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Megf10 G A 18: 57,283,862 D768N probably benign Het
Mycbp2 T C 14: 103,133,788 N4108S possibly damaging Het
Nid1 A G 13: 13,476,418 probably benign Het
Nnt A G 13: 119,396,952 V59A probably damaging Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Olfr99 T C 17: 37,279,854 T189A probably benign Het
Pag1 G A 3: 9,699,628 T155M probably benign Het
Pgam5 T C 5: 110,265,593 H176R probably damaging Het
Pid1 T C 1: 84,038,197 D149G probably damaging Het
Pkp3 G A 7: 141,082,346 M1I probably null Het
Pld2 C T 11: 70,544,123 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rab9b T A X: 136,861,449 E67D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf214 T C 9: 45,866,634 M625V possibly damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Sept10 A T 10: 59,176,887 M303K probably damaging Het
Sez6l2 A G 7: 126,959,203 E339G probably damaging Het
Sf3b1 C A 1: 54,999,991 probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
St18 A T 1: 6,844,329 K799I probably damaging Het
Strada C T 11: 106,164,822 R333Q probably damaging Het
Stradb A T 1: 58,985,385 I64L probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tnk2 A G 16: 32,679,822 D651G probably damaging Het
Trim43c A T 9: 88,847,757 D417V probably damaging Het
Tsc22d4 T C 5: 137,759,233 L374P possibly damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ubr4 T C 4: 139,452,700 V262A possibly damaging Het
Vmn2r60 A T 7: 42,116,556 N29I probably benign Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 C T 15: 88,780,787 P353S probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zwilch A T 9: 64,156,034 F286I probably benign Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7323:Abcb11 UTSW 2 69287635 missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7488:Abcb11 UTSW 2 69277802 missense probably benign
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAGGCGTGTCTCACTCTTG -3'
(R):5'- GGGCTACCTTTTGAAAAGTTGG -3'

Sequencing Primer
(F):5'- AGGCGTGTCTCACTCTTGTCTTTAG -3'
(R):5'- GCTACCTTTTGAAAAGTTGGCAAAAG -3'
Posted On2015-11-13