Mutagenetix > Incidental Mutations

Incidental Mutation 'R3772:Abcb11'

359670

Institutional Source

Beutler Lab

Gene Symbol

Abcb11

Ensembl Gene

ENSMUSG00000027048

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 11

Synonyms

PFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein

MMRRC Submission

040748-MU

Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene?

Possibly essential (E-score: 0.715) question?

Stock #

R3772 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69238282-69342616 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 69329376 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000137017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]

Predicted Effect

probably benign
Transcript: ENSMUST00000102709

SMART Domains

Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	373	1.3e-65	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1031	2.7e-55	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102710

SMART Domains

Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.7e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	3.2e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000117306

Predicted Effect

probably benign
Transcript: ENSMUST00000180142

SMART Domains

Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.4e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	2.5e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	A	T	15: 84,406,685	Y120*	probably null	Het
Adgrl1	A	G	8: 83,923,004	N97S	possibly damaging	Het
Aldh1a2	A	G	9: 71,252,920	D76G	probably damaging	Het
Aldh3a1	A	G	11: 61,214,605	E179G	possibly damaging	Het
Ap1g1	A	G	8: 109,837,786	D324G	probably damaging	Het
Arfgap2	A	G	2: 91,265,366	T12A	probably benign	Het
Aurka	A	G	2: 172,366,960	L85P	probably benign	Het
Birc6	T	A	17: 74,618,429		probably benign	Het
Bmp7	A	T	2: 172,870,222	I403N	probably damaging	Het
Carns1	A	G	19: 4,170,916		probably benign	Het
Ccdc88c	G	A	12: 100,966,100		probably benign	Het
Ccl2	C	T	11: 82,036,958	A76V	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Clstn2	A	G	9: 97,582,562	I180T	probably damaging	Het
Col24a1	T	C	3: 145,545,286	L1680P	probably damaging	Het
Col4a6	C	A	X: 141,172,200	G1416C	probably damaging	Het
Ctnna2	T	G	6: 76,973,769	N573T	probably damaging	Het
Cts8	G	A	13: 61,250,901		probably benign	Het
Cxcl17	A	G	7: 25,400,329		probably benign	Het
Defb18	T	C	1: 18,236,621	H37R	possibly damaging	Het
Dis3l2	T	C	1: 86,854,408	I229T	probably benign	Het
Dysf	G	A	6: 84,152,351	S1474N	possibly damaging	Het
Elf1	T	C	14: 79,567,210	V105A	possibly damaging	Het
F13a1	T	C	13: 36,898,134	K532R	probably benign	Het
Fmn1	T	G	2: 113,582,118	S996A	probably damaging	Het
Focad	A	C	4: 88,336,161		probably benign	Het
Frmd4a	A	T	2: 4,590,622	E109D	probably damaging	Het
Frrs1	T	G	3: 116,878,387	S45A	possibly damaging	Het
Gm5422	T	A	10: 31,248,514		noncoding transcript	Het
Gm5866	T	C	5: 52,582,746		noncoding transcript	Het
Hmcn2	C	T	2: 31,360,896	T790M	probably damaging	Het
Iglon5	A	T	7: 43,480,613	Y42*	probably null	Het
Khdrbs2	C	T	1: 32,244,076	Q90*	probably null	Het
Krt74	T	C	15: 101,762,195		noncoding transcript	Het
Lamc2	T	A	1: 153,124,251	M1121L	probably benign	Het
Lrig1	A	G	6: 94,605,817	L1073P	probably benign	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Man2c1	C	A	9: 57,140,377		probably benign	Het
Megf10	G	A	18: 57,283,862	D768N	probably benign	Het
Mycbp2	T	C	14: 103,133,788	N4108S	possibly damaging	Het
Nid1	A	G	13: 13,476,418		probably benign	Het
Nnt	A	G	13: 119,396,952	V59A	probably damaging	Het
Nsd1	G	A	13: 55,246,673	V696I	probably benign	Het
Olfr99	T	C	17: 37,279,854	T189A	probably benign	Het
Pag1	G	A	3: 9,699,628	T155M	probably benign	Het
Pgam5	T	C	5: 110,265,593	H176R	probably damaging	Het
Pid1	T	C	1: 84,038,197	D149G	probably damaging	Het
Pkp3	G	A	7: 141,082,346	M1I	probably null	Het
Pld2	C	T	11: 70,544,123		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ptprs	T	C	17: 56,428,978	T152A	possibly damaging	Het
Rab9b	T	A	X: 136,861,449	E67D	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rnf214	T	C	9: 45,866,634	M625V	possibly damaging	Het
Rwdd2a	A	C	9: 86,574,161	N130T	possibly damaging	Het
Scn9a	T	C	2: 66,483,648	N1909D	probably benign	Het
Sept10	A	T	10: 59,176,887	M303K	probably damaging	Het
Sez6l2	A	G	7: 126,959,203	E339G	probably damaging	Het
Sf3b1	C	A	1: 54,999,991		probably benign	Het
Ska3	C	T	14: 57,810,077	V334I	probably benign	Het
Srebf2	A	G	15: 82,182,108	K579R	probably benign	Het
St18	A	T	1: 6,844,329	K799I	probably damaging	Het
Strada	C	T	11: 106,164,822	R333Q	probably damaging	Het
Stradb	A	T	1: 58,985,385	I64L	probably benign	Het
Sun1	A	G	5: 139,238,820		probably benign	Het
Tecta	T	C	9: 42,330,996	T2094A	probably damaging	Het
Tenm4	A	T	7: 96,694,880	R227W	probably damaging	Het
Tnk2	A	G	16: 32,679,822	D651G	probably damaging	Het
Trim43c	A	T	9: 88,847,757	D417V	probably damaging	Het
Tsc22d4	T	C	5: 137,759,233	L374P	possibly damaging	Het
Ttn	T	C	2: 76,771,367	T16872A	probably benign	Het
Ubr4	T	C	4: 139,452,700	V262A	possibly damaging	Het
Vmn2r60	A	T	7: 42,116,556	N29I	probably benign	Het
Xrn2	T	C	2: 147,061,287	V765A	probably benign	Het
Zbed4	C	T	15: 88,780,787	P353S	probably benign	Het
Zfp251	A	G	15: 76,853,636	I414T	possibly damaging	Het
Zfp426	A	T	9: 20,473,117		probably null	Het
Zwilch	A	T	9: 64,156,034	F286I	probably benign	Het

Other mutations in Abcb11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Abcb11	APN	2	69284681	missense	possibly damaging	0.90
IGL01407:Abcb11	APN	2	69245944	missense	probably damaging	1.00
IGL01583:Abcb11	APN	2	69296409	missense	possibly damaging	0.81
IGL01813:Abcb11	APN	2	69287592	splice site	probably benign
IGL01885:Abcb11	APN	2	69287627	missense	probably damaging	1.00
IGL01937:Abcb11	APN	2	69287612	missense	probably damaging	1.00
IGL02058:Abcb11	APN	2	69243498	missense	probably damaging	0.98
IGL02117:Abcb11	APN	2	69323825	splice site	probably benign
IGL02119:Abcb11	APN	2	69328000	critical splice acceptor site	probably null
IGL02120:Abcb11	APN	2	69257310	missense	probably damaging	1.00
IGL02158:Abcb11	APN	2	69299925	missense	probably damaging	0.96
IGL02212:Abcb11	APN	2	69248889	missense	probably damaging	0.97
IGL02306:Abcb11	APN	2	69265457	nonsense	probably null
IGL02505:Abcb11	APN	2	69245761	missense	probably damaging	1.00
IGL02538:Abcb11	APN	2	69306605	missense	possibly damaging	0.67
IGL02793:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL02863:Abcb11	APN	2	69284682	missense	probably damaging	0.99
IGL02875:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL03164:Abcb11	APN	2	69291999	nonsense	probably null
IGL03181:Abcb11	APN	2	69328008	intron	probably benign
3-1:Abcb11	UTSW	2	69327993	missense	probably benign	0.00
FR4737:Abcb11	UTSW	2	69243518	missense	probably damaging	0.97
R0031:Abcb11	UTSW	2	69285308	missense	probably damaging	1.00
R0398:Abcb11	UTSW	2	69286666	missense	probably null	0.82
R0413:Abcb11	UTSW	2	69328011	intron	probably benign
R0437:Abcb11	UTSW	2	69257295	missense	probably damaging	1.00
R0496:Abcb11	UTSW	2	69277884	splice site	probably benign
R0646:Abcb11	UTSW	2	69285283	missense	probably damaging	1.00
R0669:Abcb11	UTSW	2	69329318	missense	probably benign	0.15
R0856:Abcb11	UTSW	2	69323918	missense	probably benign
R1061:Abcb11	UTSW	2	69277809	missense	probably benign	0.00
R1460:Abcb11	UTSW	2	69257374	splice site	probably benign
R1714:Abcb11	UTSW	2	69306581	missense	probably damaging	0.99
R1739:Abcb11	UTSW	2	69261566	missense	probably damaging	1.00
R1856:Abcb11	UTSW	2	69245923	missense	probably damaging	1.00
R1994:Abcb11	UTSW	2	69282670	splice site	probably null
R2086:Abcb11	UTSW	2	69259476	splice site	probably benign
R2133:Abcb11	UTSW	2	69323883	missense	possibly damaging	0.65
R2516:Abcb11	UTSW	2	69329329	missense	possibly damaging	0.88
R2930:Abcb11	UTSW	2	69257358	missense	probably damaging	0.96
R3771:Abcb11	UTSW	2	69329376	splice site	probably benign
R3979:Abcb11	UTSW	2	69323976	missense	probably benign	0.11
R4227:Abcb11	UTSW	2	69284776	missense	probably damaging	1.00
R4255:Abcb11	UTSW	2	69306605	missense	probably benign	0.03
R4614:Abcb11	UTSW	2	69284681	missense	possibly damaging	0.90
R4647:Abcb11	UTSW	2	69285271	missense	probably damaging	1.00
R4719:Abcb11	UTSW	2	69259627	missense	probably damaging	1.00
R4734:Abcb11	UTSW	2	69323962	missense	possibly damaging	0.73
R4765:Abcb11	UTSW	2	69245867	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4870:Abcb11	UTSW	2	69239196	missense	probably damaging	0.99
R4988:Abcb11	UTSW	2	69323892	missense	probably benign	0.12
R5028:Abcb11	UTSW	2	69274012	missense	probably damaging	1.00
R5048:Abcb11	UTSW	2	69308506	missense	probably benign	0.06
R5177:Abcb11	UTSW	2	69285295	missense	probably damaging	1.00
R5301:Abcb11	UTSW	2	69286847	missense	probably damaging	0.98
R5789:Abcb11	UTSW	2	69245764	missense	probably damaging	1.00
R5892:Abcb11	UTSW	2	69261500	missense	probably damaging	0.99
R6003:Abcb11	UTSW	2	69243467	missense	probably benign	0.43
R6252:Abcb11	UTSW	2	69291961	missense	probably benign	0.10
R6389:Abcb11	UTSW	2	69323894	missense	probably damaging	1.00
R6512:Abcb11	UTSW	2	69282652	missense	probably benign
R6590:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6690:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6732:Abcb11	UTSW	2	69286846	missense	probably damaging	1.00
R6870:Abcb11	UTSW	2	69285298	missense	possibly damaging	0.91
R7028:Abcb11	UTSW	2	69265675	missense	probably benign
R7223:Abcb11	UTSW	2	69274143	missense	probably benign
R7323:Abcb11	UTSW	2	69287635	missense	probably damaging	1.00
R7337:Abcb11	UTSW	2	69245769	missense	probably damaging	1.00
R7339:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7340:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7341:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7343:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7366:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7393:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7394:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7405:Abcb11	UTSW	2	69287619	missense	probably damaging	1.00
R7411:Abcb11	UTSW	2	69303936	critical splice donor site	probably null
R7488:Abcb11	UTSW	2	69277802	missense	probably benign
R7544:Abcb11	UTSW	2	69265486	missense	probably benign	0.05
R7660:Abcb11	UTSW	2	69287594	splice site	probably null
R7754:Abcb11	UTSW	2	69286818	missense	probably damaging	1.00
R7771:Abcb11	UTSW	2	69239191	missense	probably damaging	0.99
R7794:Abcb11	UTSW	2	69286678	missense	possibly damaging	0.62
R7834:Abcb11	UTSW	2	69284724	missense	probably damaging	1.00
R7897:Abcb11	UTSW	2	69323872	frame shift	probably null
R7897:Abcb11	UTSW	2	69323873	small deletion	probably benign
R7937:Abcb11	UTSW	2	69323873	small deletion	probably benign
R8004:Abcb11	UTSW	2	69257210	missense	possibly damaging	0.68
R8089:Abcb11	UTSW	2	69274039	missense	probably benign	0.09
R8279:Abcb11	UTSW	2	69239205	missense	probably benign	0.05
R8426:Abcb11	UTSW	2	69325262	missense	probably benign
R8441:Abcb11	UTSW	2	69257230	missense	possibly damaging	0.93
R8460:Abcb11	UTSW	2	69324037	missense	possibly damaging	0.70
R8462:Abcb11	UTSW	2	69274155	missense	probably benign
R8532:Abcb11	UTSW	2	69259691	missense	possibly damaging	0.69
R8534:Abcb11	UTSW	2	69323846	missense	possibly damaging	0.89
X0058:Abcb11	UTSW	2	69289443	missense	probably benign	0.12
X0062:Abcb11	UTSW	2	69245906	missense	probably damaging	1.00
X0065:Abcb11	UTSW	2	69299866	missense	probably damaging	0.99
Z1176:Abcb11	UTSW	2	69291981	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69306529	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69329269	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTAGGCGTGTCTCACTCTTG -3'
(R):5'- GGGCTACCTTTTGAAAAGTTGG -3'

Sequencing Primer
(F):5'- AGGCGTGTCTCACTCTTGTCTTTAG -3'
(R):5'- GCTACCTTTTGAAAAGTTGGCAAAAG -3'

Posted On

2015-11-13