Incidental Mutation 'R3917:Tgm1'
ID359674
Institutional Source Beutler Lab
Gene Symbol Tgm1
Ensembl Gene ENSMUSG00000022218
Gene Nametransglutaminase 1, K polypeptide
SynonymsTG K, TGase 1, protein-glutamine-gamma-glutamyltransferase, K polypeptide, 2310004J08Rik
MMRRC Submission 040914-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R3917 (G1)
Quality Score99
Status Validated
Chromosome14
Chromosomal Location55700009-55713926 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 55712757 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002389] [ENSMUST00000062861] [ENSMUST00000163889] [ENSMUST00000168729] [ENSMUST00000169237] [ENSMUST00000178034] [ENSMUST00000226907] [ENSMUST00000227061] [ENSMUST00000227958] [ENSMUST00000228123]
Predicted Effect probably benign
Transcript: ENSMUST00000002389
SMART Domains Protein: ENSMUSP00000002389
Gene: ENSMUSG00000022218

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 109 228 5.5e-35 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 1.5e-22 PFAM
Pfam:Transglut_C 690 787 1e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062861
SMART Domains Protein: ENSMUSP00000061498
Gene: ENSMUSG00000040472

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163889
SMART Domains Protein: ENSMUSP00000128668
Gene: ENSMUSG00000040472

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168729
SMART Domains Protein: ENSMUSP00000128090
Gene: ENSMUSG00000022218

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 109 228 5.5e-35 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 1.5e-22 PFAM
Pfam:Transglut_C 690 787 1e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169237
SMART Domains Protein: ENSMUSP00000133032
Gene: ENSMUSG00000040472

DomainStartEndE-ValueType
Pfam:PPTA 92 119 3.6e-12 PFAM
Pfam:PPTA 128 154 1.2e-10 PFAM
Pfam:PPTA 163 190 2e-11 PFAM
Pfam:PPTA 211 238 9e-12 PFAM
Pfam:RabGGT_insert 244 346 1.9e-46 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178034
SMART Domains Protein: ENSMUSP00000137642
Gene: ENSMUSG00000022218

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 110 226 1.2e-32 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 3.6e-24 PFAM
Pfam:Transglut_C 690 787 1.3e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226209
Predicted Effect probably benign
Transcript: ENSMUST00000226907
Predicted Effect probably benign
Transcript: ENSMUST00000227061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227106
Predicted Effect probably benign
Transcript: ENSMUST00000227958
Predicted Effect probably benign
Transcript: ENSMUST00000228123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228899
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that catalyzes the addition of an alkyl group from an akylamine to a glutamine residue of a protein, forming an alkylglutamine in the protein. This protein alkylation leads to crosslinking of proteins and catenation of polyamines to proteins. This gene contains either one or two copies of a 22 nt repeat unit in its 3' UTR. Mutations in this gene have been associated with autosomal recessive lamellar ichthyosis (LI) and nonbullous congenital ichthyosiform erythroderma (NCIE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele are small and hypoactive and die within hours of birth displaying failure to suckle, progressive dehydration, and epidermal defects including a reddish, tight and wrinkled skin, hyperkeratosis, and impaired skin barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Apol11b A G 15: 77,635,304 I192T probably benign Het
Appl1 A T 14: 26,928,604 F537Y probably damaging Het
Atad5 A C 11: 80,103,294 K785N probably null Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Bcam T C 7: 19,765,450 Y216C probably damaging Het
Brca2 A G 5: 150,540,827 E1352G probably damaging Het
C030005K15Rik A C 10: 97,725,591 S93A unknown Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Ccdc88c A G 12: 100,941,107 probably null Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Ccnt1 A G 15: 98,544,059 S443P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc42bpa T C 1: 180,106,154 probably null Het
Cdk11b T C 4: 155,626,801 S47P probably damaging Het
Cfap43 T C 19: 47,897,750 D142G probably benign Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock7 T C 4: 99,016,685 Y651C probably damaging Het
Fzd3 A T 14: 65,235,930 F130I probably damaging Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Gm1043 G A 5: 37,192,941 probably benign Het
Gm12185 A G 11: 48,915,933 F144L probably benign Het
Gm14124 T A 2: 150,266,119 probably benign Het
Gm21961 A T 15: 65,014,884 D7E unknown Het
Gtf3a A G 5: 146,955,434 K332E probably benign Het
Haao A G 17: 83,838,799 probably null Het
Habp2 T A 19: 56,311,179 C170S probably damaging Het
Heatr3 T G 8: 88,150,371 probably null Het
Herc1 T G 9: 66,434,466 C1846G possibly damaging Het
Hivep3 T C 4: 120,099,427 S1647P probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspg2 A G 4: 137,559,314 E3648G probably damaging Het
Jaml T C 9: 45,101,151 probably benign Het
Jund C T 8: 70,699,023 probably benign Het
Klra14-ps T C 6: 130,157,632 noncoding transcript Het
Krt88 G A 15: 101,452,928 probably null Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myd88 T C 9: 119,341,398 probably benign Het
Myo1d A T 11: 80,666,578 V512E probably damaging Het
Ndufv1 A G 19: 4,010,002 Y33H probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Olfr118 T A 17: 37,672,793 F257I probably damaging Het
Olfr884 A T 9: 38,047,545 I108F probably damaging Het
Patj A T 4: 98,592,008 K1317* probably null Het
Pld5 A G 1: 175,963,938 S501P probably benign Het
Pnpo A G 11: 96,939,757 V146A probably damaging Het
Ppdpf A G 2: 181,187,728 Y16C probably benign Het
Ppp1r27 A G 11: 120,550,959 V32A possibly damaging Het
Rbm28 T C 6: 29,154,789 D294G probably benign Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Shank3 A G 15: 89,503,384 D252G possibly damaging Het
Slc29a1 A T 17: 45,588,973 probably null Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a5 T C 7: 49,911,869 S50P probably damaging Het
Slfn8 A T 11: 83,016,993 Y241* probably null Het
Slu7 G T 11: 43,440,684 probably null Het
Smad2 T A 18: 76,287,937 D82E probably benign Het
Spx A C 6: 142,414,031 E33A probably damaging Het
Tdp1 A G 12: 99,894,717 Y205C probably damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Trip6 A G 5: 137,313,679 C47R probably benign Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r57 A T 7: 5,220,631 N52Y probably damaging Het
Vmn2r94 A G 17: 18,244,358 F557L probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Zic4 C A 9: 91,384,341 probably benign Het
Other mutations in Tgm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Tgm1 APN 14 55704935 missense possibly damaging 0.92
IGL02934:Tgm1 APN 14 55709989 missense probably damaging 1.00
IGL03243:Tgm1 APN 14 55705907 missense probably damaging 0.98
IGL03282:Tgm1 APN 14 55711070 missense probably damaging 1.00
PIT4458001:Tgm1 UTSW 14 55712565 missense unknown
R0277:Tgm1 UTSW 14 55710927 unclassified probably benign
R0277:Tgm1 UTSW 14 55712652 unclassified probably benign
R0478:Tgm1 UTSW 14 55700334 nonsense probably null
R1349:Tgm1 UTSW 14 55711201 unclassified probably benign
R1594:Tgm1 UTSW 14 55709519 missense probably damaging 0.96
R1776:Tgm1 UTSW 14 55709397 missense probably damaging 0.99
R1852:Tgm1 UTSW 14 55704941 missense probably damaging 1.00
R1988:Tgm1 UTSW 14 55705577 missense probably benign 0.00
R2064:Tgm1 UTSW 14 55709471 missense probably damaging 1.00
R2139:Tgm1 UTSW 14 55709543 missense probably damaging 1.00
R2427:Tgm1 UTSW 14 55712100 critical splice donor site probably null
R3710:Tgm1 UTSW 14 55712595 unclassified probably benign
R4697:Tgm1 UTSW 14 55705681 missense probably benign 0.05
R4804:Tgm1 UTSW 14 55705619 missense probably benign 0.38
R5074:Tgm1 UTSW 14 55709935 missense probably damaging 1.00
R5341:Tgm1 UTSW 14 55700248 missense possibly damaging 0.90
R5346:Tgm1 UTSW 14 55711172 missense probably damaging 0.99
R5557:Tgm1 UTSW 14 55705643 missense probably benign 0.10
R5566:Tgm1 UTSW 14 55712436 missense probably damaging 0.99
R5828:Tgm1 UTSW 14 55705554 missense probably benign 0.38
R6802:Tgm1 UTSW 14 55712482 unclassified probably benign
R7017:Tgm1 UTSW 14 55704941 missense possibly damaging 0.76
R7094:Tgm1 UTSW 14 55704843 missense possibly damaging 0.53
R7549:Tgm1 UTSW 14 55705903 missense probably benign 0.02
R7731:Tgm1 UTSW 14 55710521 missense probably benign 0.21
R7799:Tgm1 UTSW 14 55712475 missense unknown
R7915:Tgm1 UTSW 14 55700426 missense probably damaging 0.98
R7956:Tgm1 UTSW 14 55708895 missense probably benign 0.01
R8098:Tgm1 UTSW 14 55710534 missense probably damaging 1.00
R8190:Tgm1 UTSW 14 55704884 missense probably damaging 1.00
R8423:Tgm1 UTSW 14 55705643 missense probably benign 0.35
R8493:Tgm1 UTSW 14 55700297 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGTTCCCACATGAGCAG -3'
(R):5'- GGTTTCTCCACTGGACATCTG -3'

Sequencing Primer
(F):5'- TCCCACATGAGCAGCAGCC -3'
(R):5'- CTGCAATATAAGGTGCTTCTTCTG -3'
Posted On2015-11-13