Incidental Mutation 'R3769:Gm6356'
ID 359675
Institutional Source Beutler Lab
Gene Symbol Gm6356
Ensembl Gene ENSMUSG00000091400
Gene Name predicted gene 6356
Synonyms
MMRRC Submission 040746-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R3769 (G1)
Quality Score 21
Status Validated
Chromosome 14
Chromosomal Location 6965449-6973818 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 6971774 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 120 (M120I)
Ref Sequence ENSEMBL: ENSMUSP00000128748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166618]
AlphaFold L7N2A7
Predicted Effect probably benign
Transcript: ENSMUST00000166618
AA Change: M120I

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128748
Gene: ENSMUSG00000091400
AA Change: M120I

DomainStartEndE-ValueType
Pfam:Takusan 48 128 1.2e-24 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Ccer1 G A 10: 97,694,552 G359E probably damaging Het
Cdkal1 T C 13: 29,552,403 probably null Het
Celf1 T C 2: 90,998,648 V20A probably damaging Het
Cep350 G A 1: 155,953,204 T318I probably damaging Het
Chn2 A G 6: 54,290,411 D159G probably damaging Het
Chst5 T A 8: 111,889,881 D369V possibly damaging Het
Cmya5 A T 13: 93,096,693 I629K possibly damaging Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Ddx3x T C X: 13,290,569 probably benign Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Dpy19l4 T C 4: 11,276,868 probably null Het
Fgf10 G T 13: 118,781,547 V124F probably damaging Het
Gm7964 T A 7: 83,756,130 V76D probably damaging Het
Gm826 A G 2: 160,327,245 V48A unknown Het
Hoxb5 A G 11: 96,303,969 D119G possibly damaging Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Itgb2 T C 10: 77,549,968 V255A possibly damaging Het
Klf3 A G 5: 64,827,217 probably null Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Pdia6 T C 12: 17,270,456 V32A probably damaging Het
Pex6 G T 17: 46,724,385 probably null Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Polr2c G A 8: 94,860,300 A65T probably damaging Het
Ppil2 T C 16: 17,109,668 H20R probably benign Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Scn5a G A 9: 119,552,076 probably benign Het
Sh3rf3 A G 10: 58,984,191 T275A probably benign Het
Slc27a2 A G 2: 126,567,798 D300G possibly damaging Het
Slc35e1 A T 8: 72,491,870 I155N possibly damaging Het
Slco1a4 A G 6: 141,839,631 Y78H probably damaging Het
Snx15 T A 19: 6,123,954 probably benign Het
Top1 A T 2: 160,721,522 I758F probably damaging Het
U2surp A G 9: 95,493,697 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A G 9: 121,263,700 V157A probably benign Het
Urgcp T C 11: 5,717,000 Y446C probably damaging Het
Vps51 T C 19: 6,076,348 T125A possibly damaging Het
Zfp458 T A 13: 67,257,482 I298F probably damaging Het
Other mutations in Gm6356
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02637:Gm6356 APN 14 6970926 missense possibly damaging 0.59
IGL02903:Gm6356 APN 14 6973735 missense probably damaging 1.00
R7320:Gm6356 UTSW 14 6972923 missense probably damaging 0.99
R8335:Gm6356 UTSW 14 6971838 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACGACTGAGTCCAAGAGGTAC -3'
(R):5'- CATGCACTTGGCTTGGTAGTC -3'

Sequencing Primer
(F):5'- GAGGTACAAATCCAAGATCCTTGC -3'
(R):5'- GCTTGGTAGTCCATGACATAGCC -3'
Posted On 2015-11-16