Incidental Mutation 'R3912:Gbp3'
ID 359679
Institutional Source Beutler Lab
Gene Symbol Gbp3
Ensembl Gene ENSMUSG00000028268
Gene Name guanylate binding protein 3
Synonyms
MMRRC Submission 040910-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3912 (G1)
Quality Score 20
Status Validated
Chromosome 3
Chromosomal Location 142560026-142573209 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 142566338 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029935] [ENSMUST00000106221] [ENSMUST00000106222] [ENSMUST00000128609] [ENSMUST00000142060] [ENSMUST00000199325]
AlphaFold Q61107
Predicted Effect probably benign
Transcript: ENSMUST00000029935
SMART Domains Protein: ENSMUSP00000029935
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 275 7.2e-126 PFAM
Pfam:GBP_C 277 573 2.6e-126 PFAM
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106221
SMART Domains Protein: ENSMUSP00000101828
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 275 7.2e-126 PFAM
Pfam:GBP_C 277 573 2.6e-126 PFAM
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106222
SMART Domains Protein: ENSMUSP00000101829
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 275 9.6e-125 PFAM
Pfam:GBP_C 277 573 2.6e-126 PFAM
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128609
SMART Domains Protein: ENSMUSP00000117991
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 83 1.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142060
SMART Domains Protein: ENSMUSP00000120131
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 136 4.8e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142731
Predicted Effect probably benign
Transcript: ENSMUST00000199325
SMART Domains Protein: ENSMUSP00000142411
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 57 8.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylate-binding proteins, such as GBP4, are induced by interferon and hydrolyze GTP to both GDP and GMP (Vestal, 2005 [PubMed 16108726]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G T 13: 63,156,706 E402* probably null Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Acot1 A G 12: 84,017,032 S305G probably damaging Het
Acot12 A G 13: 91,770,089 D167G probably benign Het
Adgra1 T C 7: 139,845,714 probably null Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Atp2c2 A G 8: 119,721,276 K103E probably damaging Het
Camkk1 A G 11: 73,033,816 D285G probably benign Het
Ccdc158 G C 5: 92,648,935 T514S possibly damaging Het
Cdhr5 T A 7: 141,273,857 D210V probably damaging Het
Cndp1 C T 18: 84,631,999 D190N probably benign Het
Eepd1 C T 9: 25,483,304 T288M probably damaging Het
Erbin G A 13: 103,886,338 probably benign Het
Erbin G T 13: 103,862,287 T197K probably benign Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm14326 T C 2: 177,945,865 K446R probably damaging Het
Gm5724 A G 6: 141,727,636 F392S probably damaging Het
Herc2 T C 7: 56,098,437 Y518H probably damaging Het
Id2 T A 12: 25,095,872 K47* probably null Het
Ilf2 A G 3: 90,487,060 N295S probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Mroh9 C T 1: 163,066,069 C179Y probably damaging Het
Mrps18b C T 17: 35,910,939 V165I probably benign Het
Myrip A G 9: 120,432,616 S432G probably benign Het
Nutm2 C T 13: 50,472,940 A377V possibly damaging Het
Olfr700 A T 7: 106,805,865 V199D probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Pax7 C A 4: 139,780,898 W272L probably benign Het
Ppp1r12b C T 1: 134,887,318 E320K probably damaging Het
Prg4 T C 1: 150,451,868 Y278C probably damaging Het
Pvr T C 7: 19,909,292 N339D probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Ryr2 A G 13: 11,772,427 I1020T probably damaging Het
Scn4a T A 11: 106,320,716 I1492F probably damaging Het
Sec16a C T 2: 26,414,387 G2304D probably damaging Het
Shisa7 T A 7: 4,830,240 R341* probably null Het
Slc19a3 T A 1: 83,022,703 M198L probably benign Het
Slc26a8 T A 17: 28,644,779 N669Y possibly damaging Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Susd4 A T 1: 182,887,466 Y284F probably damaging Het
Tas1r1 A T 4: 152,031,924 Y418N probably damaging Het
Tdrd12 A G 7: 35,487,713 I584T probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Vmn1r39 C T 6: 66,805,141 M27I probably benign Het
Vmn2r59 T C 7: 42,046,320 T223A probably benign Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Wnt3a A C 11: 59,250,002 D229E possibly damaging Het
Other mutations in Gbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Gbp3 APN 3 142565244 unclassified probably benign
IGL01067:Gbp3 APN 3 142566597 splice site probably null
IGL02965:Gbp3 APN 3 142567582 missense probably benign 0.31
R0136:Gbp3 UTSW 3 142564101 splice site probably null
R0609:Gbp3 UTSW 3 142567772 missense probably damaging 0.99
R0671:Gbp3 UTSW 3 142565390 missense probably benign 0.17
R0673:Gbp3 UTSW 3 142565254 missense probably benign 0.45
R0786:Gbp3 UTSW 3 142570971 missense possibly damaging 0.67
R2511:Gbp3 UTSW 3 142570582 missense probably benign 0.31
R3909:Gbp3 UTSW 3 142566338 unclassified probably benign
R4816:Gbp3 UTSW 3 142567574 missense probably damaging 0.99
R5822:Gbp3 UTSW 3 142566478 missense probably benign 0.01
R6046:Gbp3 UTSW 3 142567799 missense possibly damaging 0.81
R6328:Gbp3 UTSW 3 142569058 missense probably benign 0.01
R7186:Gbp3 UTSW 3 142564162 missense probably damaging 0.97
R7536:Gbp3 UTSW 3 142566395 missense probably damaging 1.00
R7543:Gbp3 UTSW 3 142566580 missense probably damaging 0.97
R7602:Gbp3 UTSW 3 142569061 missense probably benign 0.00
R7677:Gbp3 UTSW 3 142560503 start gained probably benign
R7764:Gbp3 UTSW 3 142565263 missense probably benign 0.37
R7923:Gbp3 UTSW 3 142567612 missense probably damaging 1.00
R9099:Gbp3 UTSW 3 142565287 missense probably benign 0.02
R9102:Gbp3 UTSW 3 142567825 missense probably benign 0.01
R9440:Gbp3 UTSW 3 142566574 missense possibly damaging 0.63
R9459:Gbp3 UTSW 3 142564946 critical splice acceptor site probably null
R9760:Gbp3 UTSW 3 142570522 missense probably benign 0.01
X0025:Gbp3 UTSW 3 142566432 missense probably benign 0.42
X0062:Gbp3 UTSW 3 142561774 missense probably damaging 1.00
Z1176:Gbp3 UTSW 3 142561863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGCACTGAGGTCTCCCAATG -3'
(R):5'- TCAGAGTCTTGGTCTTGCCG -3'

Sequencing Primer
(F):5'- TGCCCCGGGTACTTTAAAAC -3'
(R):5'- TTTCTGATTCAACCTGGAAATTCCG -3'
Posted On 2015-11-17