Incidental Mutation 'R3815:Sfrp5'
ID359694
Institutional Source Beutler Lab
Gene Symbol Sfrp5
Ensembl Gene ENSMUSG00000018822
Gene Namesecreted frizzled-related sequence protein 5
SynonymsSARP3
MMRRC Submission 040770-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3815 (G1)
Quality Score54
Status Validated
Chromosome19
Chromosomal Location42197971-42202252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42198791 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 280 (R280H)
Ref Sequence ENSEMBL: ENSMUSP00000018966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018966] [ENSMUST00000169536]
Predicted Effect probably benign
Transcript: ENSMUST00000018966
AA Change: R280H

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000018966
Gene: ENSMUSG00000018822
AA Change: R280H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FRI 49 164 6.28e-58 SMART
C345C 191 294 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169536
SMART Domains Protein: ENSMUSP00000130684
Gene: ENSMUSG00000018820

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
transmembrane domain 190 212 N/A INTRINSIC
low complexity region 280 290 N/A INTRINSIC
FYVE 342 415 2.52e-4 SMART
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Secreted frizzled-related protein 5 (SFRP5) is a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. SFRPs act as soluble modulators of Wnt signaling. SFRP5 and SFRP1 may be involved in determining the polarity of photoreceptor cells in the retina. SFRP5 is highly expressed in the retinal pigment epithelium, and moderately expressed in the pancreas. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no developmental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A G 13: 68,611,225 H106R probably damaging Het
Aak1 T C 6: 86,959,042 probably benign Het
Aldh18a1 A G 19: 40,570,500 S299P probably damaging Het
Als2cr12 T G 1: 58,659,005 N379T probably damaging Het
Ankrd6 A C 4: 32,806,206 S618R probably benign Het
Apobec3 G T 15: 79,899,100 R126M possibly damaging Het
Arl8b T A 6: 108,813,697 V65D probably damaging Het
AW554918 C T 18: 25,400,047 R253C probably benign Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Cdca7l G A 12: 117,872,213 V95I probably damaging Het
Ces1e A G 8: 93,201,839 probably null Het
Coq5 T G 5: 115,295,898 F306V probably damaging Het
Cpsf1 A G 15: 76,601,149 V501A probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cul5 T A 9: 53,622,943 I630L probably benign Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Dedd A G 1: 171,338,901 E135G probably benign Het
Ecel1 A G 1: 87,152,900 F368S probably damaging Het
Ext1 A C 15: 53,345,089 I92S probably benign Het
Fbxw5 A T 2: 25,503,564 D268V possibly damaging Het
Gen1 A T 12: 11,252,033 V192E possibly damaging Het
Gm11077 T G 6: 140,729,315 V11G unknown Het
Ift88 A T 14: 57,440,981 E150V possibly damaging Het
Kcna1 T C 6: 126,643,046 R104G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt82 A G 15: 101,550,600 S2P probably damaging Het
Luc7l2 T C 6: 38,570,591 S69P possibly damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Mamstr G T 7: 45,644,532 R20L probably damaging Het
Nav1 C A 1: 135,471,124 K573N possibly damaging Het
Olfr1457 T C 19: 13,094,913 H245R probably damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Palld T A 8: 61,549,837 probably benign Het
Pcdha2 A G 18: 36,941,695 Y793C probably benign Het
Pcdhb4 A T 18: 37,308,012 D125V probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Ppp1r9b A T 11: 94,992,533 E329V probably damaging Het
Rarres1 T A 3: 67,515,321 D32V probably benign Het
Rhobtb1 A G 10: 69,285,693 H53R possibly damaging Het
Ryr1 A T 7: 29,072,902 S2494T probably damaging Het
Sapcd2 G A 2: 25,373,506 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp1 A C 15: 98,056,832 D490E probably damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Skint5 G A 4: 113,846,299 T499I possibly damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Spire1 G T 18: 67,506,663 T273K probably benign Het
Tep1 T C 14: 50,868,315 T83A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttn T A 2: 76,721,733 R29441* probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Other mutations in Sfrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Sfrp5 APN 19 42199029 missense probably benign 0.00
IGL03347:Sfrp5 APN 19 42198768 missense probably benign 0.00
R1686:Sfrp5 UTSW 19 42201704 missense possibly damaging 0.88
R1911:Sfrp5 UTSW 19 42198798 missense probably benign
R2005:Sfrp5 UTSW 19 42198836 missense probably benign 0.03
R3930:Sfrp5 UTSW 19 42201818 missense probably damaging 1.00
R5829:Sfrp5 UTSW 19 42201656 missense probably damaging 1.00
R5980:Sfrp5 UTSW 19 42201972 missense unknown
R6351:Sfrp5 UTSW 19 42201824 missense possibly damaging 0.91
R6702:Sfrp5 UTSW 19 42201827 missense probably benign 0.02
R6764:Sfrp5 UTSW 19 42199799 missense probably benign 0.00
R6836:Sfrp5 UTSW 19 42201710 missense probably damaging 0.97
R6895:Sfrp5 UTSW 19 42199788 missense probably damaging 1.00
R7024:Sfrp5 UTSW 19 42201765 missense possibly damaging 0.56
R7543:Sfrp5 UTSW 19 42198863 missense possibly damaging 0.67
R8442:Sfrp5 UTSW 19 42198797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTTGGAGCCTGTGCAGTAG -3'
(R):5'- ACCGAAAGTTGATTGGAGCCC -3'

Sequencing Primer
(F):5'- TGAAGCCATCCTTGGGGG -3'
(R):5'- AGTTGATTGGAGCCCAGAAG -3'
Posted On2015-11-23