Incidental Mutation 'R3856:Cep131'
List |< first << previous [record 12 of 53] next >> last >|
ID359697
Institutional Source Beutler Lab
Gene Symbol Cep131
Ensembl Gene ENSMUSG00000039781
Gene Namecentrosomal protein 131
SynonymsAzi1, AZ1
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R3856 (G1)
Quality Score79
Status Validated
Chromosome11
Chromosomal Location120064430-120086827 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 120067185 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 772 (R772*)
Ref Sequence ENSEMBL: ENSMUSP00000136392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106227] [ENSMUST00000106229] [ENSMUST00000180242]
Predicted Effect probably null
Transcript: ENSMUST00000106227
AA Change: R771*
SMART Domains Protein: ENSMUSP00000101834
Gene: ENSMUSG00000039781
AA Change: R771*

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 344 N/A INTRINSIC
low complexity region 395 409 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
SCOP:d1jila_ 672 756 2e-3 SMART
low complexity region 785 803 N/A INTRINSIC
low complexity region 813 826 N/A INTRINSIC
coiled coil region 874 1053 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106229
AA Change: R772*
SMART Domains Protein: ENSMUSP00000101836
Gene: ENSMUSG00000039781
AA Change: R772*

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 342 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 441 460 N/A INTRINSIC
low complexity region 562 577 N/A INTRINSIC
SCOP:d1jila_ 673 757 2e-3 SMART
low complexity region 786 804 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
coiled coil region 875 1054 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175334
Predicted Effect probably null
Transcript: ENSMUST00000180242
AA Change: R772*
SMART Domains Protein: ENSMUSP00000136392
Gene: ENSMUSG00000039781
AA Change: R772*

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 345 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 441 460 N/A INTRINSIC
low complexity region 562 577 N/A INTRINSIC
SCOP:d1jila_ 673 757 2e-3 SMART
low complexity region 786 804 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
coiled coil region 875 1054 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: The protein encoding this gene is a centriolar satellite protein that localizes around the basal body via transport along microtubules. Knockdown in mouse fibroblasts results in a reduction in ciliogenesis. Null mutant mice display no discernible ciliary phenotypes and embryonic patterning and adult homeostasis are largely unaffected. Male mice are infertile, however, due to defects in microtubule trafficking in the sperm manchette and flagella. In addition, the protein binds to a complex of proteins associated with Bardet-Biedl syndrome called the BBSome, and depletion of this protein results in an accumulation of the BBSome in cilia. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit partial preweaning lethality with no apparent defects in cilia formation or function. However, homozygotes display complete male infertility associated with spermiogenesis arrest, severe flagellar defects, and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Cep131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Cep131 APN 11 120077009 missense possibly damaging 0.55
IGL01522:Cep131 APN 11 120067163 missense probably benign 0.09
IGL01524:Cep131 APN 11 120065960 missense probably damaging 1.00
IGL02477:Cep131 APN 11 120070580 missense probably damaging 1.00
R0565:Cep131 UTSW 11 120073762 missense probably damaging 0.97
R1731:Cep131 UTSW 11 120076916 splice site probably null
R1739:Cep131 UTSW 11 120083906 missense probably benign 0.01
R1797:Cep131 UTSW 11 120073736 splice site probably null
R2444:Cep131 UTSW 11 120070495 missense probably damaging 1.00
R2899:Cep131 UTSW 11 120072028 missense probably benign 0.01
R3854:Cep131 UTSW 11 120067185 nonsense probably null
R4446:Cep131 UTSW 11 120064819 missense probably damaging 1.00
R4624:Cep131 UTSW 11 120070832 missense probably damaging 1.00
R4838:Cep131 UTSW 11 120076156 missense probably damaging 1.00
R4892:Cep131 UTSW 11 120068057 missense probably damaging 0.99
R5170:Cep131 UTSW 11 120070609 missense probably damaging 0.99
R6128:Cep131 UTSW 11 120065975 missense probably damaging 1.00
R6179:Cep131 UTSW 11 120066011 missense probably benign 0.13
R6362:Cep131 UTSW 11 120064690 missense probably damaging 0.99
R6630:Cep131 UTSW 11 120073815 missense probably damaging 1.00
R6786:Cep131 UTSW 11 120065392 missense probably damaging 1.00
R6846:Cep131 UTSW 11 120065691 missense probably damaging 1.00
R6847:Cep131 UTSW 11 120065691 missense probably damaging 1.00
R7210:Cep131 UTSW 11 120064789 missense probably damaging 0.96
R7569:Cep131 UTSW 11 120066713 missense probably damaging 1.00
RF015:Cep131 UTSW 11 120072968 critical splice acceptor site probably benign
RF054:Cep131 UTSW 11 120072968 critical splice acceptor site probably benign
Z1177:Cep131 UTSW 11 120065715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGCTGCTGCCTCAG -3'
(R):5'- GTGTGAAGATACGAAAAGCCACA -3'

Sequencing Primer
(F):5'- GCCTCAGCTCCTCCAACTCTG -3'
(R):5'- CTGAAGGAGGCTGCAGC -3'
Posted On2015-11-30