Incidental Mutation 'R4038:Zfp931'
ID359708
Institutional Source Beutler Lab
Gene Symbol Zfp931
Ensembl Gene ENSMUSG00000078861
Gene Namezinc finger protein 931
Synonyms
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4038 (G1)
Quality Score30
Status Validated
Chromosome2
Chromosomal Location178067695-178078476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 178067984 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 203 (Q203L)
Ref Sequence ENSEMBL: ENSMUSP00000104552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108923] [ENSMUST00000108924] [ENSMUST00000131702]
Predicted Effect probably benign
Transcript: ENSMUST00000108923
SMART Domains Protein: ENSMUSP00000104551
Gene: ENSMUSG00000078861

DomainStartEndE-ValueType
KRAB 4 64 2.27e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108924
AA Change: Q203L

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104552
Gene: ENSMUSG00000078861
AA Change: Q203L

DomainStartEndE-ValueType
KRAB 4 66 3.04e-14 SMART
ZnF_C2H2 78 97 2.63e2 SMART
ZnF_C2H2 103 125 1.2e-3 SMART
ZnF_C2H2 131 153 8.02e-5 SMART
ZnF_C2H2 159 181 2.12e-4 SMART
ZnF_C2H2 187 209 1.4e-4 SMART
ZnF_C2H2 215 237 2.99e-4 SMART
ZnF_C2H2 243 265 4.87e-4 SMART
ZnF_C2H2 271 293 7.49e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123265
Predicted Effect probably benign
Transcript: ENSMUST00000131702
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Other mutations in Zfp931
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02980:Zfp931 APN 2 178069616 critical splice acceptor site probably null
R1391:Zfp931 UTSW 2 178068191 missense probably benign 0.01
R1907:Zfp931 UTSW 2 178069891 missense probably damaging 1.00
R2109:Zfp931 UTSW 2 178069858 missense probably null 1.00
R2283:Zfp931 UTSW 2 178069921 missense possibly damaging 0.93
R4039:Zfp931 UTSW 2 178067984 missense possibly damaging 0.53
R4867:Zfp931 UTSW 2 178068062 missense probably damaging 1.00
R4893:Zfp931 UTSW 2 178068203 missense probably damaging 0.99
R5593:Zfp931 UTSW 2 178067802 missense possibly damaging 0.47
R7295:Zfp931 UTSW 2 178068031 nonsense probably null
R8050:Zfp931 UTSW 2 178068096 missense probably damaging 1.00
R8069:Zfp931 UTSW 2 178067916 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTGTAAAGACTATTGGTTTTCGA -3'
(R):5'- GAGTCATAGTCAAAGGCATGAAATA -3'

Sequencing Primer
(F):5'- CTGCAAAGGCTTTACCACATTGG -3'
(R):5'- GCTTTTAAAAGAAGGCGTGACCTCC -3'
Posted On2015-12-08