Incidental Mutation 'R3938:Srp54a'
ID359710
Institutional Source Beutler Lab
Gene Symbol Srp54a
Ensembl Gene ENSMUSG00000073079
Gene Namesignal recognition particle 54A
SynonymsSrp54, 54kDa, 54K subunit of signal recognition particle
MMRRC Submission 040825-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R3938 (G1)
Quality Score53
Status Validated
Chromosome12
Chromosomal Location55080262-55115367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 55089257 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 19 (N19T)
Ref Sequence ENSEMBL: ENSMUSP00000152764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021407] [ENSMUST00000220578] [ENSMUST00000221655]
Predicted Effect probably benign
Transcript: ENSMUST00000021407
AA Change: N19T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000021407
Gene: ENSMUSG00000073079
AA Change: N19T

DomainStartEndE-ValueType
SRP54_N 2 87 7.47e-19 SMART
AAA 100 277 2.15e-7 SMART
SRP54 101 296 7.25e-90 SMART
Pfam:SRP_SPB 326 431 1e-32 PFAM
low complexity region 490 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220578
AA Change: N19T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221479
Predicted Effect probably benign
Transcript: ENSMUST00000221655
AA Change: N19T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect unknown
Transcript: ENSMUST00000222027
AA Change: N11T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223111
Meta Mutation Damage Score 0.0749 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,154,294 P1561L probably damaging Het
Adamts1 C T 16: 85,795,619 V634M possibly damaging Het
Arid4b A T 13: 14,186,928 N659I probably benign Het
BC049715 T C 6: 136,840,455 I231T possibly damaging Het
Bmp4 T C 14: 46,384,079 Y336C probably damaging Het
Ccdc30 G A 4: 119,352,673 T293I probably benign Het
Chd5 A T 4: 152,377,055 T1275S probably benign Het
Chtf8 A T 8: 106,885,905 M134K probably benign Het
Col11a2 A T 17: 34,039,625 probably benign Het
Cyp8b1 A G 9: 121,915,618 V216A probably benign Het
Dnah8 C T 17: 30,854,937 T4527M probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Erap1 T A 13: 74,668,028 L92Q probably damaging Het
Exoc3l G T 8: 105,293,405 P296H probably damaging Het
Gm5294 A T 5: 138,820,968 N78Y probably damaging Het
Hacl1 T C 14: 31,634,191 probably benign Het
Hrnr T A 3: 93,322,855 N133K probably benign Het
Itgax G T 7: 128,136,273 R504S possibly damaging Het
Itgb4 A G 11: 116,005,926 S1461G possibly damaging Het
Klkb1 G T 8: 45,282,801 T175K probably damaging Het
Lrrk2 A T 15: 91,712,780 D525V possibly damaging Het
Lrrk2 C A 15: 91,778,504 T1912K probably damaging Het
Mdga1 G T 17: 29,857,622 Q59K probably damaging Het
Mpp4 A G 1: 59,124,683 V466A possibly damaging Het
Myh6 T C 14: 54,963,055 D203G probably benign Het
Myo5b T C 18: 74,716,037 S1116P probably damaging Het
Nemp1 T C 10: 127,695,473 L311P probably damaging Het
Nup205 A G 6: 35,219,742 R1138G probably damaging Het
Nup54 A G 5: 92,417,529 M443T probably damaging Het
Peak1 T C 9: 56,260,365 E93G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plekhj1 A G 10: 80,797,775 I76T probably damaging Het
Poll A G 19: 45,558,418 probably benign Het
Ppp1r3a A T 6: 14,719,074 S614T probably damaging Het
Pygm A T 19: 6,392,950 I556F probably benign Het
Ranbp2 T C 10: 58,476,472 F1005L probably benign Het
Rcor3 G T 1: 192,101,085 T361K possibly damaging Het
Robo4 A G 9: 37,402,017 probably benign Het
Rps15 T C 10: 80,293,839 V96A probably benign Het
Rrm2 T A 12: 24,709,432 N55K probably damaging Het
Shank2 T C 7: 144,128,375 Y382H probably benign Het
Slc25a10 G T 11: 120,491,993 E3* probably null Het
Slc7a8 T A 14: 54,735,841 E223V probably benign Het
Snx13 A G 12: 35,144,097 K880E probably benign Het
Spinkl T G 18: 44,168,149 M41L probably benign Het
Sun2 T C 15: 79,734,155 K268E probably benign Het
Sytl1 G A 4: 133,255,624 Q359* probably null Het
Tlr6 A T 5: 64,953,595 F656L probably damaging Het
Tmem185a C T X: 70,462,186 probably null Het
Tmem45a2 C T 16: 57,039,035 D278N probably benign Het
Trav7-1 T C 14: 52,655,334 probably benign Het
Trpc2 T A 7: 102,093,574 M597K probably damaging Het
Ttc21a A G 9: 119,950,816 probably benign Het
Usp9y C T Y: 1,313,741 M2188I probably damaging Het
Utrn C A 10: 12,750,030 probably null Het
Vmn1r35 T A 6: 66,679,073 R204S probably damaging Het
Zfp955b T A 17: 33,305,416 Y59F probably damaging Het
Other mutations in Srp54a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03368:Srp54a APN 12 55091266 missense probably null 0.79
R3890:Srp54a UTSW 12 55089193 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TTAAAGTTGCAGGTTGAGGTACTAG -3'
(R):5'- TGCAAAGCACTCCTGACTGTTAC -3'

Sequencing Primer
(F):5'- TTGCAGGTTGAGGTACTAGAAGCTAC -3'
(R):5'- TCCTGACTGTTACTGGGTATTTATAG -3'
Posted On2015-12-08