Incidental Mutation 'R3907:Rcan1'
List |< first << previous [record 46 of 62] next >> last >|
ID359714
Institutional Source Beutler Lab
Gene Symbol Rcan1
Ensembl Gene ENSMUSG00000022951
Gene Nameregulator of calcineurin 1
SynonymsMCIP1, 2410048A02Rik, ADAPT78, Dscr1, CSP1
MMRRC Submission 040908-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3907 (G1)
Quality Score43
Status Validated
Chromosome16
Chromosomal Location92391953-92470867 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 92466029 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060005] [ENSMUST00000232197] [ENSMUST00000232239]
Predicted Effect unknown
Transcript: ENSMUST00000060005
AA Change: V17A
SMART Domains Protein: ENSMUSP00000060394
Gene: ENSMUSG00000022951
AA Change: V17A

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
low complexity region 39 46 N/A INTRINSIC
Pfam:Calcipressin 73 245 3.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231968
Predicted Effect probably benign
Transcript: ENSMUST00000232197
Predicted Effect probably benign
Transcript: ENSMUST00000232239
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with calcineurin A and inhibits calcineurin-dependent signaling pathways, possibly affecting central nervous system development. This gene is located in the minimal candidate region for the Down syndrome phenotype, and is overexpressed in the brain of Down syndrome fetuses. Chronic overexpression of this gene may lead to neurofibrillary tangles such as those associated with Alzheimer disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Unstressed homozygous mutant mice show no overt phenotype other than a slight reduction in heart size and an impaired T helper 1 response. Stress-induced cardiac hypertrophy, however, is attenuated in mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Gphn T A 12: 78,493,942 probably benign Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Rcan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0944:Rcan1 UTSW 16 92393491 missense probably damaging 1.00
R0973:Rcan1 UTSW 16 92393520 missense probably benign 0.04
R2303:Rcan1 UTSW 16 92393596 missense possibly damaging 0.80
R2340:Rcan1 UTSW 16 92397352 missense probably damaging 1.00
R4352:Rcan1 UTSW 16 92393496 missense probably benign 0.11
R4857:Rcan1 UTSW 16 92465906 missense possibly damaging 0.77
R6072:Rcan1 UTSW 16 92465927 missense probably benign 0.01
R6991:Rcan1 UTSW 16 92397363 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AAAGCTCGTCTCCAGTGTC -3'
(R):5'- AAAGGGAACGTTCTTGGGCTC -3'

Sequencing Primer
(F):5'- GCTCGTCTCCAGTGTCTGAGAC -3'
(R):5'- AGAGCTACGATTCGAGGCC -3'
Posted On2015-12-08