Incidental Mutation 'R3966:Safb2'
ID359718
Institutional Source Beutler Lab
Gene Symbol Safb2
Ensembl Gene ENSMUSG00000042625
Gene Namescaffold attachment factor B2
Synonyms
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.610) question?
Stock #R3966 (G1)
Quality Score37
Status Validated
Chromosome17
Chromosomal Location56560965-56584585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56575356 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 426 (S426G)
Ref Sequence ENSEMBL: ENSMUSP00000074953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075510] [ENSMUST00000131056] [ENSMUST00000133604] [ENSMUST00000144255] [ENSMUST00000155983]
Predicted Effect probably null
Transcript: ENSMUST00000075510
AA Change: S426G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074953
Gene: ENSMUSG00000042625
AA Change: S426G

DomainStartEndE-ValueType
SAP 25 59 8.21e-11 SMART
low complexity region 91 104 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
coiled coil region 262 285 N/A INTRINSIC
low complexity region 286 294 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
RRM 452 525 1.33e-19 SMART
low complexity region 557 578 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
coiled coil region 658 772 N/A INTRINSIC
low complexity region 798 815 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124457
Predicted Effect probably benign
Transcript: ENSMUST00000131056
SMART Domains Protein: ENSMUSP00000120750
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
low complexity region 44 65 N/A INTRINSIC
low complexity region 118 133 N/A INTRINSIC
coiled coil region 146 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133604
SMART Domains Protein: ENSMUSP00000119324
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
SAP 25 59 8.21e-11 SMART
low complexity region 91 104 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140037
Predicted Effect probably benign
Transcript: ENSMUST00000144255
SMART Domains Protein: ENSMUSP00000123673
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
SAP 25 59 8.21e-11 SMART
low complexity region 91 104 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146958
Predicted Effect probably benign
Transcript: ENSMUST00000155983
SMART Domains Protein: ENSMUSP00000116363
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
SAP 25 59 8.21e-11 SMART
low complexity region 91 104 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156640
SMART Domains Protein: ENSMUSP00000118127
Gene: ENSMUSG00000042625

DomainStartEndE-ValueType
low complexity region 62 86 N/A INTRINSIC
Meta Mutation Damage Score 0.1230 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, along with its paralog (scaffold attachment factor B1), is a repressor of estrogen receptor alpha. The encoded protein binds scaffold/matrix attachment region (S/MAR) DNA and is involved in cell cycle regulation, apoptosis, differentiation, the stress response, and regulation of immune genes. [provided by RefSeq, May 2016]
PHENOTYPE: Male homozyous mutant mice exhibit an increase in testis weight and an increased number of Sertoli cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Safb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Safb2 APN 17 56571208 critical splice donor site probably null
IGL00954:Safb2 APN 17 56578639 critical splice donor site probably null
IGL01085:Safb2 APN 17 56565242 nonsense probably null
IGL03073:Safb2 APN 17 56571289 missense probably benign 0.06
R0748:Safb2 UTSW 17 56575580 missense probably benign 0.30
R1297:Safb2 UTSW 17 56584265 unclassified probably benign
R1876:Safb2 UTSW 17 56576909 splice site probably null
R2921:Safb2 UTSW 17 56568906 missense possibly damaging 0.46
R5140:Safb2 UTSW 17 56577901 missense probably benign 0.01
R5484:Safb2 UTSW 17 56575346 intron probably benign
R5542:Safb2 UTSW 17 56575647 missense probably damaging 0.97
R5602:Safb2 UTSW 17 56575630 missense possibly damaging 0.65
R5801:Safb2 UTSW 17 56563103 missense possibly damaging 0.96
R5864:Safb2 UTSW 17 56566491 unclassified probably benign
R5985:Safb2 UTSW 17 56563181 missense possibly damaging 0.72
R6060:Safb2 UTSW 17 56563246 splice site probably null
R6279:Safb2 UTSW 17 56563226 missense possibly damaging 0.53
R6300:Safb2 UTSW 17 56563226 missense possibly damaging 0.53
R6411:Safb2 UTSW 17 56571289 missense probably benign 0.06
R6555:Safb2 UTSW 17 56567600 missense probably damaging 1.00
R6555:Safb2 UTSW 17 56582982 critical splice donor site probably null
R7039:Safb2 UTSW 17 56564594 missense possibly damaging 0.82
R7515:Safb2 UTSW 17 56582982 critical splice donor site probably null
R7796:Safb2 UTSW 17 56566327 missense possibly damaging 0.53
R8186:Safb2 UTSW 17 56566051 missense possibly damaging 0.91
R8361:Safb2 UTSW 17 56583061 missense probably damaging 0.99
X0066:Safb2 UTSW 17 56565978 missense probably benign 0.29
Z1186:Safb2 UTSW 17 56563246 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTTAAGAACCCAACGATGGCAGG -3'
(R):5'- GCTAGAGGAGCCAGTTGAAC -3'

Sequencing Primer
(F):5'- CCCAACGATGGCAGGTTGAG -3'
(R):5'- AACAGAGTAGCACGGCTGCC -3'
Posted On2015-12-08