Incidental Mutation 'R3810:Gm20939'
ID359719
Institutional Source Beutler Lab
Gene Symbol Gm20939
Ensembl Gene ENSMUSG00000095193
Gene Namepredicted gene, 20939
Synonyms
MMRRC Submission 040880-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R3810 (G1)
Quality Score32
Status Validated
Chromosome17
Chromosomal Location94873986-94877497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94876710 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 262 (R262K)
Ref Sequence ENSEMBL: ENSMUSP00000103642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108007]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108007
AA Change: R262K

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103642
Gene: ENSMUSG00000095193
AA Change: R262K

DomainStartEndE-ValueType
KRAB 3 65 7.59e-15 SMART
ZnF_C2H2 130 152 5.21e-4 SMART
ZnF_C2H2 158 180 1.18e-2 SMART
ZnF_C2H2 186 208 2.12e-4 SMART
ZnF_C2H2 214 236 2.57e-3 SMART
ZnF_C2H2 242 264 1.3e-4 SMART
ZnF_C2H2 270 292 2.99e-4 SMART
ZnF_C2H2 298 320 7.9e-4 SMART
ZnF_C2H2 326 348 1.6e-4 SMART
ZnF_C2H2 354 376 4.24e-4 SMART
ZnF_C2H2 382 404 2.79e-4 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 1.22e-4 SMART
ZnF_C2H2 466 488 4.17e-3 SMART
ZnF_C2H2 494 516 1.6e-4 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T A 14: 8,045,603 V173D probably benign Het
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Ahcyl2 A G 6: 29,891,261 I455V probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Ctbp1 A G 5: 33,267,045 probably benign Het
D130040H23Rik T A 8: 69,302,370 C160S probably damaging Het
Dapk1 T C 13: 60,760,689 W1039R probably damaging Het
Dock6 T C 9: 21,801,577 K1995E probably damaging Het
Entpd3 A G 9: 120,562,002 E440G probably benign Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Gm9847 T C 12: 14,495,147 noncoding transcript Het
H2-Q6 A G 17: 35,425,781 E182G probably damaging Het
Has1 T C 17: 17,847,560 Y356C probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl35 A G 7: 99,470,241 D311G probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Mrgpra9 T A 7: 47,235,779 I47F probably damaging Het
Muc5b T C 7: 141,864,126 L3603P possibly damaging Het
Neurl4 A G 11: 69,904,033 H323R probably damaging Het
Oas1d A T 5: 120,914,986 I35F probably damaging Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1232 G A 2: 89,325,754 T142M probably benign Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Orc6 T A 8: 85,299,984 S19R probably benign Het
Pcdh12 T C 18: 38,281,237 E945G probably damaging Het
Plekha6 A G 1: 133,273,979 M377V probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Tas2r130 A G 6: 131,630,829 M1T probably null Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trgv2 T C 13: 19,336,841 T28A possibly damaging Het
Trpc4ap T A 2: 155,643,435 I448F probably damaging Het
Ttc21b C T 2: 66,252,233 probably null Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Uvrag A G 7: 98,979,712 Y383H probably damaging Het
Vim T C 2: 13,578,752 probably null Het
Other mutations in Gm20939
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Gm20939 APN 17 94874293 splice site probably benign
R0015:Gm20939 UTSW 17 94876768 missense probably benign 0.00
R1563:Gm20939 UTSW 17 94877094 missense probably damaging 1.00
R1714:Gm20939 UTSW 17 94875806 missense probably damaging 1.00
R2029:Gm20939 UTSW 17 94875824 splice site probably benign
R2922:Gm20939 UTSW 17 94877293 missense probably damaging 1.00
R2923:Gm20939 UTSW 17 94877293 missense probably damaging 1.00
R3158:Gm20939 UTSW 17 94877293 missense probably damaging 1.00
R4158:Gm20939 UTSW 17 94876734 missense possibly damaging 0.72
R4304:Gm20939 UTSW 17 94877281 missense probably benign
R4307:Gm20939 UTSW 17 94876734 missense possibly damaging 0.72
R5080:Gm20939 UTSW 17 94876991 missense probably damaging 1.00
R5271:Gm20939 UTSW 17 94877155 nonsense probably null
R5661:Gm20939 UTSW 17 94875779 missense probably damaging 1.00
R5771:Gm20939 UTSW 17 94874339 missense possibly damaging 0.93
R6800:Gm20939 UTSW 17 94877229 missense possibly damaging 0.75
Z1088:Gm20939 UTSW 17 94877433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTCTCATGGTCAACTTCA -3'
(R):5'- TTACTATATGGAAAGGCTTTACCACAT -3'

Sequencing Primer
(F):5'- TCTCATGGTCAACTTCAAGCACATG -3'
(R):5'- TGACTGTGTCGTCCAAAGAC -3'
Posted On2015-12-09