Incidental Mutation 'R3933:Arhgef33'
ID359729
Institutional Source Beutler Lab
Gene Symbol Arhgef33
Ensembl Gene ENSMUSG00000054901
Gene NameRho guanine nucleotide exchange factor (GEF) 33
SynonymsLOC381112, Gm941
MMRRC Submission 040920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3933 (G1)
Quality Score20
Status Validated
Chromosome17
Chromosomal Location80307407-80400081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80373320 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 630 (I630V)
Ref Sequence ENSEMBL: ENSMUSP00000153224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068175] [ENSMUST00000086549] [ENSMUST00000223878] [ENSMUST00000224966] [ENSMUST00000225223] [ENSMUST00000225548] [ENSMUST00000225658]
Predicted Effect probably benign
Transcript: ENSMUST00000068175
AA Change: I630V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000063284
Gene: ENSMUSG00000054901
AA Change: I630V

DomainStartEndE-ValueType
coiled coil region 64 128 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
Pfam:RhoGEF 277 446 4.7e-16 PFAM
low complexity region 455 473 N/A INTRINSIC
low complexity region 510 520 N/A INTRINSIC
low complexity region 620 629 N/A INTRINSIC
low complexity region 751 770 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000086549
SMART Domains Protein: ENSMUSP00000083736
Gene: ENSMUSG00000066938

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
low complexity region 43 72 N/A INTRINSIC
low complexity region 75 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223878
AA Change: I630V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224676
Predicted Effect probably benign
Transcript: ENSMUST00000224966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225018
Predicted Effect probably benign
Transcript: ENSMUST00000225223
Predicted Effect probably benign
Transcript: ENSMUST00000225548
Predicted Effect probably benign
Transcript: ENSMUST00000225658
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,354,856 F3350L probably damaging Het
Acp6 T C 3: 97,166,183 V146A probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Astn2 G A 4: 66,403,955 R136C unknown Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
C1rl T A 6: 124,508,822 L384* probably null Het
Ccdc130 G A 8: 84,260,352 A172V probably benign Het
Ccdc6 TCCGCCGCCGCC TCCGCCGCC 10: 70,189,170 probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ercc5 T A 1: 44,167,856 M643K probably benign Het
Fut8 A C 12: 77,475,259 K557N probably damaging Het
Hsdl2 T C 4: 59,597,274 Y88H probably damaging Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Lepr T C 4: 101,765,301 probably benign Het
Matn2 T C 15: 34,345,420 probably null Het
Mei1 A G 15: 82,083,152 K310E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Ogdh T C 11: 6,342,601 V438A possibly damaging Het
Olfr1109 T A 2: 87,092,762 I212F probably benign Het
Olfr1293-ps T C 2: 111,527,955 Y232H probably damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Parp2 G A 14: 50,819,387 V323M probably benign Het
Pip5k1a A G 3: 95,072,003 S161P probably benign Het
Pold3 T C 7: 100,121,401 E8G probably damaging Het
Pomt1 G A 2: 32,245,619 V332I probably benign Het
Ppp2ca T A 11: 52,119,262 N232K probably damaging Het
Prune2 A T 19: 17,123,954 D2274V probably damaging Het
Pwwp2b G A 7: 139,256,034 V464I possibly damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rubcn A G 16: 32,829,259 probably null Het
Scai A T 2: 39,075,052 D593E probably benign Het
Slc24a2 T C 4: 87,176,185 T366A probably benign Het
Sp100 A G 1: 85,681,109 I320V probably benign Het
Syngr2 C A 11: 117,813,417 P206Q probably damaging Het
Tatdn3 A T 1: 191,046,324 probably null Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r11 C T 5: 109,053,394 A415T probably damaging Het
Vmn2r88 A G 14: 51,413,978 M258V probably benign Het
Wiz G A 17: 32,357,898 R561C probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Other mutations in Arhgef33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Arhgef33 APN 17 80368230 missense probably benign 0.33
IGL00784:Arhgef33 APN 17 80368230 missense probably benign 0.33
IGL01601:Arhgef33 APN 17 80347683 missense probably damaging 1.00
IGL01647:Arhgef33 APN 17 80365266 splice site probably benign
IGL02654:Arhgef33 APN 17 80370311 missense probably damaging 1.00
IGL02712:Arhgef33 APN 17 80360373 missense probably damaging 1.00
R0195:Arhgef33 UTSW 17 80381434 missense probably damaging 0.96
R0732:Arhgef33 UTSW 17 80381354 missense possibly damaging 0.90
R0834:Arhgef33 UTSW 17 80347597 splice site probably benign
R1144:Arhgef33 UTSW 17 80355044 missense probably benign
R1465:Arhgef33 UTSW 17 80367301 missense possibly damaging 0.88
R1465:Arhgef33 UTSW 17 80367301 missense possibly damaging 0.88
R1513:Arhgef33 UTSW 17 80371389 missense probably benign
R1680:Arhgef33 UTSW 17 80347651 missense probably damaging 0.96
R1696:Arhgef33 UTSW 17 80349506 missense probably damaging 1.00
R1775:Arhgef33 UTSW 17 80373743 missense probably benign 0.05
R2046:Arhgef33 UTSW 17 80373466 missense probably benign 0.08
R4573:Arhgef33 UTSW 17 80365282 missense probably damaging 1.00
R5222:Arhgef33 UTSW 17 80337314 missense probably damaging 1.00
R5269:Arhgef33 UTSW 17 80370275 missense probably damaging 1.00
R5933:Arhgef33 UTSW 17 80337280 missense probably benign
R6460:Arhgef33 UTSW 17 80349589 splice site probably null
R7307:Arhgef33 UTSW 17 80347120 critical splice acceptor site probably null
R7594:Arhgef33 UTSW 17 80370305 missense probably damaging 1.00
R7746:Arhgef33 UTSW 17 80347120 critical splice acceptor site probably null
R7895:Arhgef33 UTSW 17 80373485 missense probably benign 0.00
R7956:Arhgef33 UTSW 17 80355048 missense possibly damaging 0.81
R8508:Arhgef33 UTSW 17 80367335 missense probably damaging 1.00
Z1177:Arhgef33 UTSW 17 80384230 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGCCTCATGGAGAGCATG -3'
(R):5'- GACGGCTGGGTTTTACTTTACC -3'

Sequencing Primer
(F):5'- CGGGAAGCCTGGAGACTG -3'
(R):5'- AACTCCTTGAGCGAGCGG -3'
Posted On2015-12-11