Incidental Mutation 'R4095:Entpd7'
ID 359748
Institutional Source Beutler Lab
Gene Symbol Entpd7
Ensembl Gene ENSMUSG00000025192
Gene Name ectonucleoside triphosphate diphosphohydrolase 7
Synonyms 1810020C02Rik, 2810003F23Rik, 1810012B13Rik, LALP1, Lysal2
MMRRC Submission 040858-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R4095 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 43689672-43733697 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43704201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 65 (Y65C)
Ref Sequence ENSEMBL: ENSMUSP00000079864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081079]
AlphaFold Q3TCT4
Predicted Effect probably damaging
Transcript: ENSMUST00000081079
AA Change: Y65C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079864
Gene: ENSMUSG00000025192
AA Change: Y65C

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Pfam:GDA1_CD39 75 534 3.6e-106 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144314
Meta Mutation Damage Score 0.2320 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (59/61)
MGI Phenotype PHENOTYPE: Mice homozygous for deletions in this gene have increased Th17 T cell levels in the lamina propria of the small intestine. They show increased resistance to Citrobacter rodentium infection and increased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 A T 12: 53,139,462 I1220L probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Apba1 A T 19: 23,944,024 Q737L probably benign Het
Arvcf T A 16: 18,401,577 D564E probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Brd9 G A 13: 73,944,799 V302I probably benign Het
Brinp3 C A 1: 146,901,692 H626N possibly damaging Het
C1qc T C 4: 136,890,326 N153S probably benign Het
Casp3 G A 8: 46,634,216 G66D probably damaging Het
Coq7 T G 7: 118,527,478 probably null Het
Dach1 C T 14: 97,901,379 V491M possibly damaging Het
Dda1 A G 8: 71,473,792 T52A possibly damaging Het
Fmnl2 A G 2: 53,101,523 D350G probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Gbp2 A G 3: 142,637,449 T576A probably benign Het
Gm15446 T A 5: 109,940,724 probably null Het
Gtf2a1 G T 12: 91,575,637 T57K possibly damaging Het
Hps5 T C 7: 46,775,794 E494G probably benign Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Hydin A G 8: 110,541,547 N2886S probably damaging Het
Ighv2-6-8 T C 12: 113,796,153 Y112C probably damaging Het
Kcnf1 A T 12: 17,175,479 L247Q possibly damaging Het
Kndc1 A G 7: 139,937,025 M1606V possibly damaging Het
Krt27 T C 11: 99,345,793 T431A probably benign Het
Lama4 A T 10: 39,097,122 I1562F probably damaging Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp1b G A 2: 41,449,191 T880I probably benign Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Mapt T C 11: 104,310,536 probably null Het
Mpdz A T 4: 81,383,823 V229D possibly damaging Het
Olfr1349 T A 7: 6,515,253 S59C possibly damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr49 T C 14: 54,282,731 T55A probably benign Het
Parm1 T C 5: 91,594,180 S136P probably benign Het
Pcdhgb2 T A 18: 37,690,950 S331R probably benign Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Rell1 C A 5: 63,968,670 V22L probably benign Het
Sema6c T A 3: 95,173,194 L901Q probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a23 A G 13: 34,305,206 L116P probably damaging Het
Slit1 A T 19: 41,608,486 probably benign Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Tmem104 T A 11: 115,243,923 Y427* probably null Het
Tmem74 G A 15: 43,867,282 Q122* probably null Het
Tnpo2 T A 8: 85,038,419 L10Q probably damaging Het
Trav6-2 G T 14: 52,667,815 A98S probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ube2b A C 11: 51,997,827 V39G possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Wnk1 G A 6: 119,948,126 T1459I probably damaging Het
Zc3h7a T C 16: 11,145,235 K754R probably damaging Het
Zfp605 A G 5: 110,127,736 K240R probably damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Other mutations in Entpd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Entpd7 APN 19 43729839 missense probably benign 0.00
R0056:Entpd7 UTSW 19 43725294 missense probably benign 0.09
R0118:Entpd7 UTSW 19 43704312 nonsense probably null
R0639:Entpd7 UTSW 19 43691094 missense probably benign 0.42
R1479:Entpd7 UTSW 19 43721840 missense probably damaging 1.00
R1532:Entpd7 UTSW 19 43691077 missense possibly damaging 0.76
R1647:Entpd7 UTSW 19 43721745 splice site probably benign
R1689:Entpd7 UTSW 19 43725476 missense probably damaging 0.96
R2230:Entpd7 UTSW 19 43721816 missense probably benign 0.07
R2231:Entpd7 UTSW 19 43721816 missense probably benign 0.07
R2422:Entpd7 UTSW 19 43728088 missense possibly damaging 0.66
R3807:Entpd7 UTSW 19 43725540 critical splice donor site probably null
R3914:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R3949:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4021:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4022:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4737:Entpd7 UTSW 19 43691195 nonsense probably null
R5582:Entpd7 UTSW 19 43704994 missense probably damaging 1.00
R5653:Entpd7 UTSW 19 43691157 nonsense probably null
R5763:Entpd7 UTSW 19 43704266 missense probably damaging 1.00
R6508:Entpd7 UTSW 19 43691086 missense probably damaging 1.00
R7657:Entpd7 UTSW 19 43725467 missense possibly damaging 0.67
R8013:Entpd7 UTSW 19 43728055 missense probably benign 0.00
R8235:Entpd7 UTSW 19 43717545 missense probably damaging 1.00
R8880:Entpd7 UTSW 19 43704407 splice site probably benign
R9318:Entpd7 UTSW 19 43704270 missense possibly damaging 0.88
R9564:Entpd7 UTSW 19 43717450 missense probably benign 0.01
Z1176:Entpd7 UTSW 19 43725358 missense probably benign 0.43
Z1177:Entpd7 UTSW 19 43725497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGTAGCACACCGAATACC -3'
(R):5'- TTTCTTAACCACGGGCTGGC -3'

Sequencing Primer
(F):5'- GGCTACATAGTGAAACCCTGTCTCG -3'
(R):5'- TAACCACGGGCTGGCTGTTC -3'
Posted On 2015-12-16