Mutagenetix > Incidental Mutation

Incidental Mutation 'R3937:Mroh2a'

359754

Institutional Source

Beutler Lab

Gene Symbol

Mroh2a

Ensembl Gene

ENSMUSG00000079429

Gene Name

maestro heat-like repeat family member 2A

Synonyms

Heatr7b1, ENSMUSG00000044873, OTTMUSG00000020804

MMRRC Submission

040921-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R3937 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88226986-88262289 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88258664 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 64 (S64G)

Ref Sequence

ENSEMBL: ENSMUSP00000118971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000113130] [ENSMUST00000135948]

AlphaFold

D3Z750

Predicted Effect

probably benign
Transcript: ENSMUST00000054674

SMART Domains

Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	11	68	1.5e-10	PFAM
low complexity region	159	175	N/A	INTRINSIC
low complexity region	215	232	N/A	INTRINSIC
Pfam:HJURP_mid	254	370	7.6e-54	PFAM
Pfam:HJURP_C	385	446	3.1e-26	PFAM
low complexity region	496	515	N/A	INTRINSIC
Pfam:HJURP_C	527	585	7.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000061013
AA Change: S1567G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: S1567G

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113130
AA Change: S1559G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: S1559G

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135948
AA Change: S64G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000118971
Gene: ENSMUSG00000079429
AA Change: S64G

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	15	174	5e-6	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	G	4: 147,942,053	S343R	possibly damaging	Het
Abca8b	G	T	11: 109,974,567	P355T	probably benign	Het
Abhd15	T	C	11: 77,515,938	V247A	probably benign	Het
Adamts1	C	T	16: 85,795,619	V634M	possibly damaging	Het
BC049715	T	C	6: 136,840,455	I231T	possibly damaging	Het
Chpf	A	T	1: 75,477,540	V198E	probably damaging	Het
Cp	C	T	3: 19,971,034	P386S	probably damaging	Het
Cth	A	G	3: 157,920,040	I107T	possibly damaging	Het
Ctrc	T	C	4: 141,840,321	D157G	probably damaging	Het
D630003M21Rik	A	G	2: 158,200,360	Y889H	probably damaging	Het
Elavl3	A	G	9: 22,018,744	V288A	probably damaging	Het
Esyt3	A	T	9: 99,336,192	I130K	probably benign	Het
F13a1	A	T	13: 36,916,901	V423D	probably damaging	Het
Faf1	T	C	4: 109,757,692		probably benign	Het
Fam227b	A	T	2: 126,127,060	D31E	probably benign	Het
Fastkd2	A	G	1: 63,737,836	D377G	possibly damaging	Het
Fbxl6	G	A	15: 76,536,624	R384*	probably null	Het
Fcamr	A	T	1: 130,804,576	H44L	probably damaging	Het
Fhod3	A	G	18: 25,090,761	N1055D	probably benign	Het
Garem1	A	T	18: 21,148,806	Y164*	probably null	Het
Gemin4	C	T	11: 76,212,888	C349Y	probably damaging	Het
Gnal	A	G	18: 67,135,370		probably null	Het
Hacl1	T	C	14: 31,634,191		probably benign	Het
Hectd3	T	C	4: 116,998,530	V409A	probably benign	Het
Hps6	A	G	19: 46,004,053	E143G	probably damaging	Het
Hspa4	T	A	11: 53,270,949	I459L	probably benign	Het
Ighv3-6	G	A	12: 114,288,441	Q21*	probably null	Het
Ints3	G	A	3: 90,403,987	R438*	probably null	Het
Jmjd6	T	C	11: 116,841,165	N237D	probably benign	Het
Lrrk2	C	A	15: 91,778,504	T1912K	probably damaging	Het
Mdga2	C	A	12: 67,221,206		probably benign	Het
Myh6	T	C	14: 54,963,055	D203G	probably benign	Het
Myo5b	T	C	18: 74,716,037	S1116P	probably damaging	Het
Nalcn	T	A	14: 123,369,945	D704V	probably benign	Het
Nes	A	T	3: 87,971,236	M12L	probably benign	Het
Olfr1052	T	A	2: 86,298,016	S67T	probably damaging	Het
Olfr118	A	G	17: 37,672,967	T315A	probably benign	Het
Olfr1328	T	C	4: 118,934,683	D53G	probably damaging	Het
Olfr453	T	A	6: 42,744,076	I13N	probably damaging	Het
Pcdha2	T	C	18: 36,941,323	V669A	probably benign	Het
Pdhx	T	C	2: 103,022,219	N433S	probably damaging	Het
Pip5kl1	A	G	2: 32,579,112	R261G	probably damaging	Het
Plekhj1	A	G	10: 80,797,775	I76T	probably damaging	Het
Ppp1r3a	A	T	6: 14,719,074	S614T	probably damaging	Het
Ptpru	T	C	4: 131,774,304	N1207S	probably damaging	Het
Ranbp2	T	C	10: 58,476,472	F1005L	probably benign	Het
Rims2	A	G	15: 39,437,845	E324G	probably damaging	Het
Sema6d	A	T	2: 124,656,850	I227L	probably benign	Het
Smarcad1	T	G	6: 65,114,336	L1014V	probably damaging	Het
Spag9	T	C	11: 94,044,417	V18A	possibly damaging	Het
Spag9	T	G	11: 94,044,479	S39A	possibly damaging	Het
Sun2	T	C	15: 79,734,155	K268E	probably benign	Het
Tbpl2	C	T	2: 24,087,139	R289Q	probably benign	Het
Tcea3	T	A	4: 136,255,143		probably benign	Het
Tmem185a	C	T	X: 70,462,186		probably null	Het
Tnrc6c	C	T	11: 117,723,529	R838W	probably damaging	Het
Vmn1r212	A	T	13: 22,883,188	V325E	unknown	Het
Vmn1r35	T	A	6: 66,679,073	R204S	probably damaging	Het
Vmn2r57	A	G	7: 41,428,130	M204T	probably damaging	Het
Wdfy3	A	T	5: 101,944,239	Y411*	probably null	Het
Zfp335	G	T	2: 164,910,700	D41E	probably damaging	Het

Other mutations in Mroh2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Mroh2a	APN	1	88230746	missense	probably damaging	0.99
IGL00990:Mroh2a	APN	1	88244970	missense	probably benign	0.03
IGL00990:Mroh2a	APN	1	88234120	missense	possibly damaging	0.76
IGL03097:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R0032:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0068:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0139:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R0197:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R0242:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0322:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0374:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0387:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R0412:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
R0536:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0548:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0580:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0581:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0583:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0613:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0652:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0657:Mroh2a	UTSW	1	88255565	missense	probably damaging	1.00
R0659:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0659:Mroh2a	UTSW	1	88250342	missense	probably damaging	1.00
R0671:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0675:Mroh2a	UTSW	1	88228380	missense	probably damaging	0.99
R0675:Mroh2a	UTSW	1	88250342	missense	probably damaging	1.00
R0689:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0689:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0735:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0761:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0766:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0845:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0853:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0959:Mroh2a	UTSW	1	88232257	frame shift	probably null
R0960:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1004:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1013:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R1028:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R1268:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1281:Mroh2a	UTSW	1	88256167	frame shift	probably null
R1414:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R1439:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R1441:Mroh2a	UTSW	1	88241631	missense	possibly damaging	0.93
R1442:Mroh2a	UTSW	1	88232353	splice site	probably benign
R1442:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1465:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R1662:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R1686:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1686:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R1780:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1846:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R1899:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R1958:Mroh2a	UTSW	1	88237491	nonsense	probably null
R2122:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R2248:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R2306:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R2869:Mroh2a	UTSW	1	88232257	frame shift	probably null
R2870:Mroh2a	UTSW	1	88232257	frame shift	probably null
R2871:Mroh2a	UTSW	1	88255565	missense	probably damaging	1.00
R2872:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3408:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3608:Mroh2a	UTSW	1	88244995	missense	probably damaging	1.00
R3730:Mroh2a	UTSW	1	88232257	frame shift	probably null
R4022:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R4049:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4133:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4361:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4392:Mroh2a	UTSW	1	88259589	missense	probably damaging	1.00
R4401:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4402:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4575:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4625:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4631:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4665:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R4701:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R4701:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R4771:Mroh2a	UTSW	1	88251365	missense	probably damaging	1.00
R4795:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4839:Mroh2a	UTSW	1	88237944	missense	probably damaging	1.00
R4873:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4875:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4896:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R5007:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5031:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5062:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5301:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5367:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R5371:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5446:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R5484:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5506:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5561:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5615:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5825:Mroh2a	UTSW	1	88230680	nonsense	probably null
R5891:Mroh2a	UTSW	1	88241615	missense	possibly damaging	0.93
R5906:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5928:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R6004:Mroh2a	UTSW	1	88248655	missense	probably damaging	1.00
R6035:Mroh2a	UTSW	1	88230668	missense	probably damaging	1.00
R6064:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6074:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R6091:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6127:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R6244:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R6464:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R6465:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6575:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6809:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
R6819:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R6854:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R6860:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R7126:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R7818:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R8350:Mroh2a	UTSW	1	88244083	splice site	probably null
R9414:Mroh2a	UTSW	1	88251374	missense	probably benign	0.26
RF024:Mroh2a	UTSW	1	88242485	missense	probably damaging	1.00
V5622:Mroh2a	UTSW	1	88227091	start gained	probably benign
V8831:Mroh2a	UTSW	1	88256167	frame shift	probably null
X0027:Mroh2a	UTSW	1	88248613	missense	possibly damaging	0.86
X0028:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0028:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0033:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0034:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0034:Mroh2a	UTSW	1	88232292	missense	probably damaging	1.00
X0034:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0039:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0057:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0057:Mroh2a	UTSW	1	88255655	missense	probably benign	0.25
X0057:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0063:Mroh2a	UTSW	1	88232257	frame shift	probably null
Z1188:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
Z1190:Mroh2a	UTSW	1	88232257	frame shift	probably null
Z1192:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGCTGTAGAGCCCTTTCTG -3'
(R):5'- AGAGCATTCCTTCCTGTCAGG -3'

Sequencing Primer
(F):5'- TGGGGCTGCTCTCTCTC -3'
(R):5'- ACCTTCCTGGACTTTGAAGATTG -3'

Posted On

2015-12-17