Mutagenetix > Incidental Mutation

Incidental Mutation 'R0348:Vmn2r68'

35990

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

Vmn2r68-ps, EG620697

MMRRC Submission

038555-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R0348 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85221518-85237704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 85221676 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 800 (T800P)

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061074
AA Change: T800P

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: T800P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921536K21Rik	T	C	11: 3,894,987	D34G	probably benign	Het
Adam6a	T	C	12: 113,544,717	S237P	probably damaging	Het
Adamts13	A	C	2: 26,981,080	D235A	probably benign	Het
Adgb	T	A	10: 10,357,879	M1259L	probably benign	Het
Apbb1	T	C	7: 105,565,303	Q529R	probably damaging	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Camta1	T	C	4: 151,586,431	T96A	possibly damaging	Het
Ccdc148	A	T	2: 59,004,072		probably null	Het
Cep170b	T	C	12: 112,736,806	Y568H	probably damaging	Het
Clca4b	A	T	3: 144,921,980	I410N	probably damaging	Het
Cnot10	G	A	9: 114,598,770	T592I	probably benign	Het
Col6a3	C	T	1: 90,828,049	A173T	probably damaging	Het
Ctcf	T	A	8: 105,676,157	C560*	probably null	Het
Daglb	G	A	5: 143,487,196	V369I	probably benign	Het
Defb19	G	A	2: 152,580,226	L8F	unknown	Het
Emcn	G	T	3: 137,372,847	E65*	probably null	Het
Etl4	G	T	2: 20,778,129	R753L	probably damaging	Het
Fam151b	T	C	13: 92,450,181	Y248C	probably benign	Het
Fmo1	T	C	1: 162,836,135	D275G	probably benign	Het
Gjd4	A	G	18: 9,280,964	V38A	possibly damaging	Het
Hivep1	T	C	13: 42,158,379	V1365A	possibly damaging	Het
Hivep2	T	C	10: 14,129,958	S767P	possibly damaging	Het
Hoxa6	T	C	6: 52,206,568	T166A	possibly damaging	Het
Ift80	G	T	3: 68,935,899	L367I	probably benign	Het
Igf2bp1	T	C	11: 95,968,893	N369S	possibly damaging	Het
Igsf11	C	A	16: 39,008,817	D24E	probably benign	Het
Ints5	C	T	19: 8,895,750	L358F	probably damaging	Het
Kbtbd3	A	G	9: 4,330,519	T298A	possibly damaging	Het
Kif28	C	A	1: 179,731,253	V297F	probably damaging	Het
Krt12	T	C	11: 99,417,945	Y422C	probably damaging	Het
Lig1	T	A	7: 13,309,197	W856R	probably damaging	Het
Liph	C	T	16: 21,967,980		probably null	Het
Lrig3	T	A	10: 126,013,448	C1012*	probably null	Het
Lrit1	A	G	14: 37,060,225	E285G	probably damaging	Het
Lrrc31	A	G	3: 30,689,228	V196A	probably benign	Het
Lrrn4	T	C	2: 132,870,443	T487A	probably benign	Het
Mllt10	T	C	2: 18,162,613	Y372H	probably damaging	Het
Mrpl50	A	T	4: 49,514,515	V52E	probably damaging	Het
Mthfd1l	T	C	10: 4,056,766	V676A	probably damaging	Het
Ncl	C	T	1: 86,356,640	D245N	possibly damaging	Het
Neil1	A	T	9: 57,146,781		probably null	Het
Nfatc3	A	G	8: 106,092,195	E515G	probably damaging	Het
Nlrp4b	A	G	7: 10,715,181	E70G	possibly damaging	Het
Nme3	A	T	17: 24,896,517	I2F	possibly damaging	Het
Nup210	G	A	6: 91,074,310	H364Y	probably benign	Het
Nxpe3	T	A	16: 55,866,535	T37S	probably benign	Het
Olfm1	T	A	2: 28,212,542	M76K	probably benign	Het
Pgbd5	A	T	8: 124,434,032	V32E	probably damaging	Het
Plcb4	T	C	2: 135,968,419	M646T	probably damaging	Het
Plekha7	G	A	7: 116,158,020	P565L	probably damaging	Het
Poc5	A	G	13: 96,398,866	D213G	probably null	Het
Poli	A	G	18: 70,523,381	I125T	probably benign	Het
Ppm1f	T	C	16: 16,903,390	M1T	probably null	Het
Psmd7	T	C	8: 107,580,891	K320R	unknown	Het
Rabggtb	A	G	3: 153,910,317	V128A	probably damaging	Het
Rasa2	A	T	9: 96,571,959	L308H	probably damaging	Het
Serpina1d	C	T	12: 103,763,775	V383M	probably benign	Het
Sipa1l1	T	C	12: 82,384,756		probably null	Het
Sos1	T	C	17: 80,408,311	T1006A	probably benign	Het
Sugp1	T	A	8: 70,070,008	Y453N	probably damaging	Het
Taf3	A	T	2: 10,042,644	D64E	probably benign	Het
Tcf19	A	T	17: 35,515,904		probably null	Het
Trim60	T	A	8: 65,001,216	H127L	probably damaging	Het
Tubb4a	C	T	17: 57,080,770	V419M	probably damaging	Het
Vmn2r22	G	T	6: 123,637,725	T302K	probably damaging	Het
Zfhx2	A	C	14: 55,063,508	V2262G	probably damaging	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	85237611	missense	probably benign
IGL01477:Vmn2r68	APN	7	85233483	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	85222260	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	85222117	missense	probably benign
IGL01999:Vmn2r68	APN	7	85222231	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	85221739	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	85221945	nonsense	probably null
IGL02827:Vmn2r68	APN	7	85237592	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	85233387	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	85234441	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	85222240	nonsense	probably null
IGL03166:Vmn2r68	APN	7	85222123	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	85221764	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	85233755	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0280:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0281:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0390:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0390:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0722:Vmn2r68	UTSW	7	85221586	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	85237504	splice site	probably null
R1136:Vmn2r68	UTSW	7	85222341	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	85232492	missense	probably damaging	0.96
R1614:Vmn2r68	UTSW	7	85221738	missense	possibly damaging	0.93
R1682:Vmn2r68	UTSW	7	85233366	missense	possibly damaging	0.68
R1837:Vmn2r68	UTSW	7	85233678	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	85234659	nonsense	probably null
R1908:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	85233894	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	85221915	missense	probably benign	0.01
R2178:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2185:Vmn2r68	UTSW	7	85233693	nonsense	probably null
R2188:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2282:Vmn2r68	UTSW	7	85221651	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	85234595	missense	probably benign
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2874:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	85237667	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R3978:Vmn2r68	UTSW	7	85232462	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4421:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4478:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4479:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4495:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4628:Vmn2r68	UTSW	7	85234465	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	85221535	missense	probably benign
R4654:Vmn2r68	UTSW	7	85233561	nonsense	probably null
R4793:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	85232414	missense	probably benign
R5021:Vmn2r68	UTSW	7	85233734	missense	possibly damaging	0.62
R5082:Vmn2r68	UTSW	7	85233868	missense	probably benign	0.12
R5177:Vmn2r68	UTSW	7	85221991	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	85221877	missense	probably damaging	1.00
R5514:Vmn2r68	UTSW	7	85237559	missense	possibly damaging	0.92
R5521:Vmn2r68	UTSW	7	85233718	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	85222075	missense	probably damaging	1.00
R5664:Vmn2r68	UTSW	7	85233770	missense	probably benign	0.02
R5829:Vmn2r68	UTSW	7	85237604	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	85222245	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	85233840	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	85221765	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	85233707	missense	probably benign
R6699:Vmn2r68	UTSW	7	85232375	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	85222252	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	85233834	missense	probably benign
R7374:Vmn2r68	UTSW	7	85232399	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	85232379	missense	probably damaging	1.00
R7605:Vmn2r68	UTSW	7	85233908	missense	probably benign	0.01
R7892:Vmn2r68	UTSW	7	85234514	missense	probably benign
R7979:Vmn2r68	UTSW	7	85234417	critical splice donor site	probably null
R8177:Vmn2r68	UTSW	7	85222214	nonsense	probably null
R8349:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	85221900	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	85237514	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	85222113	missense	possibly damaging	0.68
R9056:Vmn2r68	UTSW	7	85222212	missense	possibly damaging	0.71
R9342:Vmn2r68	UTSW	7	85233785	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	85233549	missense	possibly damaging	0.54
V7581:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
Z1176:Vmn2r68	UTSW	7	85221733	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	85222081	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	85222099	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GGAGTAGAAGCAGCTTTGTAAAAGTGTAGAT -3'
(R):5'- AGCATTCAAAATAACCATTCCAGGAAGAAGA -3'

Sequencing Primer
(F):5'- AGCATTTGCATGTGGTTTCCTG -3'
(R):5'- TGCACACATGGTACATGGC -3'

Posted On

2013-05-09