Incidental Mutation 'R0348:Nfatc3'
ID35997
Institutional Source Beutler Lab
Gene Symbol Nfatc3
Ensembl Gene ENSMUSG00000031902
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3
SynonymsNFATx, NFAT4, D8Ertd281e
MMRRC Submission 038555-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0348 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106058840-106130537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106092195 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 515 (E515G)
Ref Sequence ENSEMBL: ENSMUSP00000148551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]
Predicted Effect probably damaging
Transcript: ENSMUST00000109308
AA Change: E523G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902
AA Change: E523G

DomainStartEndE-ValueType
low complexity region 153 182 N/A INTRINSIC
low complexity region 205 225 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
Pfam:RHD_DNA_bind 434 593 4.9e-25 PFAM
IPT 600 699 1.19e-20 SMART
low complexity region 713 722 N/A INTRINSIC
low complexity region 917 938 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211991
AA Change: E515G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212691
Predicted Effect probably damaging
Transcript: ENSMUST00000212742
AA Change: E515G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212936
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T C 11: 3,894,987 D34G probably benign Het
Adam6a T C 12: 113,544,717 S237P probably damaging Het
Adamts13 A C 2: 26,981,080 D235A probably benign Het
Adgb T A 10: 10,357,879 M1259L probably benign Het
Apbb1 T C 7: 105,565,303 Q529R probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Camta1 T C 4: 151,586,431 T96A possibly damaging Het
Ccdc148 A T 2: 59,004,072 probably null Het
Cep170b T C 12: 112,736,806 Y568H probably damaging Het
Clca4b A T 3: 144,921,980 I410N probably damaging Het
Cnot10 G A 9: 114,598,770 T592I probably benign Het
Col6a3 C T 1: 90,828,049 A173T probably damaging Het
Ctcf T A 8: 105,676,157 C560* probably null Het
Daglb G A 5: 143,487,196 V369I probably benign Het
Defb19 G A 2: 152,580,226 L8F unknown Het
Emcn G T 3: 137,372,847 E65* probably null Het
Etl4 G T 2: 20,778,129 R753L probably damaging Het
Fam151b T C 13: 92,450,181 Y248C probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gjd4 A G 18: 9,280,964 V38A possibly damaging Het
Hivep1 T C 13: 42,158,379 V1365A possibly damaging Het
Hivep2 T C 10: 14,129,958 S767P possibly damaging Het
Hoxa6 T C 6: 52,206,568 T166A possibly damaging Het
Ift80 G T 3: 68,935,899 L367I probably benign Het
Igf2bp1 T C 11: 95,968,893 N369S possibly damaging Het
Igsf11 C A 16: 39,008,817 D24E probably benign Het
Ints5 C T 19: 8,895,750 L358F probably damaging Het
Kbtbd3 A G 9: 4,330,519 T298A possibly damaging Het
Kif28 C A 1: 179,731,253 V297F probably damaging Het
Krt12 T C 11: 99,417,945 Y422C probably damaging Het
Lig1 T A 7: 13,309,197 W856R probably damaging Het
Liph C T 16: 21,967,980 probably null Het
Lrig3 T A 10: 126,013,448 C1012* probably null Het
Lrit1 A G 14: 37,060,225 E285G probably damaging Het
Lrrc31 A G 3: 30,689,228 V196A probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Mllt10 T C 2: 18,162,613 Y372H probably damaging Het
Mrpl50 A T 4: 49,514,515 V52E probably damaging Het
Mthfd1l T C 10: 4,056,766 V676A probably damaging Het
Ncl C T 1: 86,356,640 D245N possibly damaging Het
Neil1 A T 9: 57,146,781 probably null Het
Nlrp4b A G 7: 10,715,181 E70G possibly damaging Het
Nme3 A T 17: 24,896,517 I2F possibly damaging Het
Nup210 G A 6: 91,074,310 H364Y probably benign Het
Nxpe3 T A 16: 55,866,535 T37S probably benign Het
Olfm1 T A 2: 28,212,542 M76K probably benign Het
Pgbd5 A T 8: 124,434,032 V32E probably damaging Het
Plcb4 T C 2: 135,968,419 M646T probably damaging Het
Plekha7 G A 7: 116,158,020 P565L probably damaging Het
Poc5 A G 13: 96,398,866 D213G probably null Het
Poli A G 18: 70,523,381 I125T probably benign Het
Ppm1f T C 16: 16,903,390 M1T probably null Het
Psmd7 T C 8: 107,580,891 K320R unknown Het
Rabggtb A G 3: 153,910,317 V128A probably damaging Het
Rasa2 A T 9: 96,571,959 L308H probably damaging Het
Serpina1d C T 12: 103,763,775 V383M probably benign Het
Sipa1l1 T C 12: 82,384,756 probably null Het
Sos1 T C 17: 80,408,311 T1006A probably benign Het
Sugp1 T A 8: 70,070,008 Y453N probably damaging Het
Taf3 A T 2: 10,042,644 D64E probably benign Het
Tcf19 A T 17: 35,515,904 probably null Het
Trim60 T A 8: 65,001,216 H127L probably damaging Het
Tubb4a C T 17: 57,080,770 V419M probably damaging Het
Vmn2r22 G T 6: 123,637,725 T302K probably damaging Het
Vmn2r68 T G 7: 85,221,676 T800P possibly damaging Het
Zfhx2 A C 14: 55,063,508 V2262G probably damaging Het
Other mutations in Nfatc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Nfatc3 APN 8 106099177 missense probably damaging 1.00
IGL01755:Nfatc3 APN 8 106127921 missense probably benign 0.42
IGL02314:Nfatc3 APN 8 106078900 missense probably benign 0.21
IGL02724:Nfatc3 APN 8 106108185 missense probably benign 0.29
Struggles UTSW 8 106083870 nonsense probably null
PIT1430001:Nfatc3 UTSW 8 106059973 missense possibly damaging 0.78
PIT4515001:Nfatc3 UTSW 8 106079203 missense possibly damaging 0.94
R0088:Nfatc3 UTSW 8 106127942 missense possibly damaging 0.90
R0410:Nfatc3 UTSW 8 106096196 missense probably damaging 1.00
R1509:Nfatc3 UTSW 8 106083854 missense possibly damaging 0.46
R1702:Nfatc3 UTSW 8 106092160 missense probably damaging 1.00
R1735:Nfatc3 UTSW 8 106083834 missense probably damaging 1.00
R1736:Nfatc3 UTSW 8 106078850 missense probably damaging 1.00
R1758:Nfatc3 UTSW 8 106099136 missense probably damaging 1.00
R2370:Nfatc3 UTSW 8 106108455 missense probably damaging 1.00
R2878:Nfatc3 UTSW 8 106092144 missense probably damaging 1.00
R3802:Nfatc3 UTSW 8 106079645 missense probably damaging 0.99
R3959:Nfatc3 UTSW 8 106099077 nonsense probably null
R4006:Nfatc3 UTSW 8 106108839 missense probably benign 0.00
R4079:Nfatc3 UTSW 8 106079491 missense probably damaging 0.98
R4589:Nfatc3 UTSW 8 106079073 missense probably damaging 1.00
R4818:Nfatc3 UTSW 8 106108379 missense probably benign 0.00
R4907:Nfatc3 UTSW 8 106079727 missense probably damaging 1.00
R5042:Nfatc3 UTSW 8 106108125 missense probably benign 0.25
R5632:Nfatc3 UTSW 8 106079057 missense probably damaging 1.00
R5741:Nfatc3 UTSW 8 106079066 missense probably damaging 1.00
R5885:Nfatc3 UTSW 8 106096312 missense probably benign 0.00
R6439:Nfatc3 UTSW 8 106083870 nonsense probably null
R6557:Nfatc3 UTSW 8 106119354 missense probably benign 0.01
R6737:Nfatc3 UTSW 8 106083969 missense probably damaging 1.00
R6925:Nfatc3 UTSW 8 106119322 missense probably benign 0.00
R7260:Nfatc3 UTSW 8 106108946 missense probably benign 0.00
R7429:Nfatc3 UTSW 8 106108403 missense probably benign 0.00
R7430:Nfatc3 UTSW 8 106108403 missense probably benign 0.00
R7526:Nfatc3 UTSW 8 106079083 missense probably damaging 1.00
R7760:Nfatc3 UTSW 8 106108341 missense possibly damaging 0.66
X0063:Nfatc3 UTSW 8 106083939 missense probably damaging 1.00
X0064:Nfatc3 UTSW 8 106108349 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ggtcaggctctcaCGGGTTACTTTA -3'
(R):5'- ACCCAAAGCCAAACAAACCATGCAG -3'

Sequencing Primer
(F):5'- ctctcaCGGGTTACTTTACTGTC -3'
(R):5'- tcctggaagctggaattatagac -3'
Posted On2013-05-09