Mutagenetix > Incidental Mutation

Incidental Mutation 'R0348:Adgb'

36005

Institutional Source

Beutler Lab

Gene Symbol

Adgb

Ensembl Gene

ENSMUSG00000050994

Gene Name

androglobin

Synonyms

9130014G24Rik

MMRRC Submission

038555-MU

Accession Numbers

MGI:3605549

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0348 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10335703-10472326 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 10357879 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1259 (M1259L)

Ref Sequence

ENSEMBL: ENSMUSP00000146658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]

AlphaFold

G3UZ78

Predicted Effect

probably benign
Transcript: ENSMUST00000148816

SMART Domains

Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
Blast:CysPc	1	41	1e-19	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172530
AA Change: M1283L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: M1283L

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179956
AA Change: M1285L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: M1285L

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208717
AA Change: M1259L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921536K21Rik	T	C	11: 3,894,987	D34G	probably benign	Het
Adam6a	T	C	12: 113,544,717	S237P	probably damaging	Het
Adamts13	A	C	2: 26,981,080	D235A	probably benign	Het
Apbb1	T	C	7: 105,565,303	Q529R	probably damaging	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Camta1	T	C	4: 151,586,431	T96A	possibly damaging	Het
Ccdc148	A	T	2: 59,004,072		probably null	Het
Cep170b	T	C	12: 112,736,806	Y568H	probably damaging	Het
Clca4b	A	T	3: 144,921,980	I410N	probably damaging	Het
Cnot10	G	A	9: 114,598,770	T592I	probably benign	Het
Col6a3	C	T	1: 90,828,049	A173T	probably damaging	Het
Ctcf	T	A	8: 105,676,157	C560*	probably null	Het
Daglb	G	A	5: 143,487,196	V369I	probably benign	Het
Defb19	G	A	2: 152,580,226	L8F	unknown	Het
Emcn	G	T	3: 137,372,847	E65*	probably null	Het
Etl4	G	T	2: 20,778,129	R753L	probably damaging	Het
Fam151b	T	C	13: 92,450,181	Y248C	probably benign	Het
Fmo1	T	C	1: 162,836,135	D275G	probably benign	Het
Gjd4	A	G	18: 9,280,964	V38A	possibly damaging	Het
Hivep1	T	C	13: 42,158,379	V1365A	possibly damaging	Het
Hivep2	T	C	10: 14,129,958	S767P	possibly damaging	Het
Hoxa6	T	C	6: 52,206,568	T166A	possibly damaging	Het
Ift80	G	T	3: 68,935,899	L367I	probably benign	Het
Igf2bp1	T	C	11: 95,968,893	N369S	possibly damaging	Het
Igsf11	C	A	16: 39,008,817	D24E	probably benign	Het
Ints5	C	T	19: 8,895,750	L358F	probably damaging	Het
Kbtbd3	A	G	9: 4,330,519	T298A	possibly damaging	Het
Kif28	C	A	1: 179,731,253	V297F	probably damaging	Het
Krt12	T	C	11: 99,417,945	Y422C	probably damaging	Het
Lig1	T	A	7: 13,309,197	W856R	probably damaging	Het
Liph	C	T	16: 21,967,980		probably null	Het
Lrig3	T	A	10: 126,013,448	C1012*	probably null	Het
Lrit1	A	G	14: 37,060,225	E285G	probably damaging	Het
Lrrc31	A	G	3: 30,689,228	V196A	probably benign	Het
Lrrn4	T	C	2: 132,870,443	T487A	probably benign	Het
Mllt10	T	C	2: 18,162,613	Y372H	probably damaging	Het
Mrpl50	A	T	4: 49,514,515	V52E	probably damaging	Het
Mthfd1l	T	C	10: 4,056,766	V676A	probably damaging	Het
Ncl	C	T	1: 86,356,640	D245N	possibly damaging	Het
Neil1	A	T	9: 57,146,781		probably null	Het
Nfatc3	A	G	8: 106,092,195	E515G	probably damaging	Het
Nlrp4b	A	G	7: 10,715,181	E70G	possibly damaging	Het
Nme3	A	T	17: 24,896,517	I2F	possibly damaging	Het
Nup210	G	A	6: 91,074,310	H364Y	probably benign	Het
Nxpe3	T	A	16: 55,866,535	T37S	probably benign	Het
Olfm1	T	A	2: 28,212,542	M76K	probably benign	Het
Pgbd5	A	T	8: 124,434,032	V32E	probably damaging	Het
Plcb4	T	C	2: 135,968,419	M646T	probably damaging	Het
Plekha7	G	A	7: 116,158,020	P565L	probably damaging	Het
Poc5	A	G	13: 96,398,866	D213G	probably null	Het
Poli	A	G	18: 70,523,381	I125T	probably benign	Het
Ppm1f	T	C	16: 16,903,390	M1T	probably null	Het
Psmd7	T	C	8: 107,580,891	K320R	unknown	Het
Rabggtb	A	G	3: 153,910,317	V128A	probably damaging	Het
Rasa2	A	T	9: 96,571,959	L308H	probably damaging	Het
Serpina1d	C	T	12: 103,763,775	V383M	probably benign	Het
Sipa1l1	T	C	12: 82,384,756		probably null	Het
Sos1	T	C	17: 80,408,311	T1006A	probably benign	Het
Sugp1	T	A	8: 70,070,008	Y453N	probably damaging	Het
Taf3	A	T	2: 10,042,644	D64E	probably benign	Het
Tcf19	A	T	17: 35,515,904		probably null	Het
Trim60	T	A	8: 65,001,216	H127L	probably damaging	Het
Tubb4a	C	T	17: 57,080,770	V419M	probably damaging	Het
Vmn2r22	G	T	6: 123,637,725	T302K	probably damaging	Het
Vmn2r68	T	G	7: 85,221,676	T800P	possibly damaging	Het
Zfhx2	A	C	14: 55,063,508	V2262G	probably damaging	Het

Other mutations in Adgb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Adgb	APN	10	10406099	missense	possibly damaging	0.87
IGL01083:Adgb	APN	10	10407554	missense	possibly damaging	0.50
IGL03064:Adgb	APN	10	10400572	missense	probably benign	0.02
R0080:Adgb	UTSW	10	10377839	splice site	probably benign
R0084:Adgb	UTSW	10	10396344	missense	possibly damaging	0.74
R0112:Adgb	UTSW	10	10407158	splice site	probably benign
R0415:Adgb	UTSW	10	10431067	splice site	probably null
R0633:Adgb	UTSW	10	10391729	missense	probably benign	0.36
R1052:Adgb	UTSW	10	10442613	missense	probably benign	0.29
R1248:Adgb	UTSW	10	10395310	missense	probably damaging	0.98
R1278:Adgb	UTSW	10	10382828	missense	probably damaging	1.00
R1568:Adgb	UTSW	10	10442665	nonsense	probably null
R1647:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1648:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1663:Adgb	UTSW	10	10339675	missense	possibly damaging	0.86
R1688:Adgb	UTSW	10	10350317	nonsense	probably null
R1758:Adgb	UTSW	10	10426605	missense	probably damaging	1.00
R1772:Adgb	UTSW	10	10382721	splice site	probably benign
R1850:Adgb	UTSW	10	10442502	missense	probably damaging	1.00
R1959:Adgb	UTSW	10	10395249	missense	probably benign	0.02
R1980:Adgb	UTSW	10	10433498	missense	probably benign
R2179:Adgb	UTSW	10	10395274	missense	possibly damaging	0.94
R2229:Adgb	UTSW	10	10436051	missense	probably damaging	1.00
R2283:Adgb	UTSW	10	10377891	missense	probably damaging	0.99
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2875:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2876:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2920:Adgb	UTSW	10	10390243	missense	probably damaging	1.00
R2931:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R3722:Adgb	UTSW	10	10340510	missense	probably benign	0.32
R3846:Adgb	UTSW	10	10382721	splice site	probably benign
R3877:Adgb	UTSW	10	10442483	critical splice donor site	probably null
R4210:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4211:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4333:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R4448:Adgb	UTSW	10	10390825	missense	probably benign	0.32
R4470:Adgb	UTSW	10	10398951	missense	probably benign	0.02
R4624:Adgb	UTSW	10	10403004	missense	probably benign	0.00
R4656:Adgb	UTSW	10	10405306	missense	probably damaging	0.99
R4676:Adgb	UTSW	10	10426710	missense	probably damaging	1.00
R4792:Adgb	UTSW	10	10398903	missense	probably damaging	0.96
R4795:Adgb	UTSW	10	10357872	missense	probably benign	0.01
R4858:Adgb	UTSW	10	10349577	missense	probably damaging	1.00
R4985:Adgb	UTSW	10	10400632	missense	possibly damaging	0.69
R5057:Adgb	UTSW	10	10357978	missense	probably benign	0.11
R5157:Adgb	UTSW	10	10398966	missense	probably damaging	1.00
R5209:Adgb	UTSW	10	10398937	missense	possibly damaging	0.71
R5339:Adgb	UTSW	10	10442606	missense	probably damaging	1.00
R5376:Adgb	UTSW	10	10346563	missense	probably benign	0.09
R5426:Adgb	UTSW	10	10350260	missense	probably benign	0.14
R5516:Adgb	UTSW	10	10431157	missense	probably damaging	1.00
R5554:Adgb	UTSW	10	10340473	missense	probably damaging	0.98
R5678:Adgb	UTSW	10	10431326	missense	possibly damaging	0.83
R5707:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5708:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5891:Adgb	UTSW	10	10377847	nonsense	probably null
R5928:Adgb	UTSW	10	10378787	missense	probably damaging	1.00
R6005:Adgb	UTSW	10	10395352	missense	probably damaging	1.00
R6017:Adgb	UTSW	10	10450036	missense	probably damaging	1.00
R6049:Adgb	UTSW	10	10378026	missense	probably damaging	1.00
R6118:Adgb	UTSW	10	10431291	missense	probably damaging	1.00
R6175:Adgb	UTSW	10	10398943	missense	possibly damaging	0.94
R6186:Adgb	UTSW	10	10422758	missense	probably damaging	1.00
R6234:Adgb	UTSW	10	10353080	splice site	probably null
R6383:Adgb	UTSW	10	10450028	missense	probably damaging	1.00
R6522:Adgb	UTSW	10	10377892	nonsense	probably null
R6639:Adgb	UTSW	10	10435956	missense	possibly damaging	0.51
R6697:Adgb	UTSW	10	10406126	nonsense	probably null
R6742:Adgb	UTSW	10	10411849	missense	probably damaging	1.00
R6745:Adgb	UTSW	10	10390197	missense	probably damaging	1.00
R6850:Adgb	UTSW	10	10394574	missense	probably benign	0.39
R7128:Adgb	UTSW	10	10472241	missense	probably benign	0.26
R7326:Adgb	UTSW	10	10400574	missense	possibly damaging	0.80
R7386:Adgb	UTSW	10	10377949	missense	possibly damaging	0.52
R7431:Adgb	UTSW	10	10391955	splice site	probably null
R7569:Adgb	UTSW	10	10431252	missense	probably benign
R7579:Adgb	UTSW	10	10410818	nonsense	probably null
R7582:Adgb	UTSW	10	10390821	missense	probably damaging	1.00
R7615:Adgb	UTSW	10	10436010	missense	probably damaging	0.96
R7692:Adgb	UTSW	10	10411712	critical splice donor site	probably null
R7774:Adgb	UTSW	10	10339660	nonsense	probably null
R7808:Adgb	UTSW	10	10378659	splice site	probably null
R8158:Adgb	UTSW	10	10378734	missense	probably benign	0.22
R8386:Adgb	UTSW	10	10350304	missense	probably damaging	1.00
R8746:Adgb	UTSW	10	10405284	critical splice donor site	probably null
R8785:Adgb	UTSW	10	10357966	missense	probably damaging	1.00
R9089:Adgb	UTSW	10	10442688	missense	probably benign	0.26
R9140:Adgb	UTSW	10	10340519	nonsense	probably null
R9386:Adgb	UTSW	10	10398964	missense	probably benign	0.00
R9777:Adgb	UTSW	10	10407470	missense	possibly damaging	0.74
X0003:Adgb	UTSW	10	10394630	missense	possibly damaging	0.76
Z1176:Adgb	UTSW	10	10378742	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GGGTCTAACTTCATTGCTATTCTTCCCTAAC -3'
(R):5'- gcctcctggctTGACCTAATGTCTTT -3'

Sequencing Primer
(F):5'- gacacacccattccaacaag -3'
(R):5'- ctggctTGACCTAATGTCTTTCAATG -3'

Posted On

2013-05-09