Incidental Mutation 'R0348:Liph'
Institutional Source Beutler Lab
Gene Symbol Liph
Ensembl Gene ENSMUSG00000044626
Gene Namelipase, member H
SynonymsD16Wsu119e, mPA-PLA1, PLA1B, C130037N08Rik, LPDLR, Lpdlr
MMRRC Submission 038555-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0348 (G1)
Quality Score221
Status Not validated
Chromosomal Location21953817-21995663 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 21967980 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060673] [ENSMUST00000074230] [ENSMUST00000231682] [ENSMUST00000231766]
Predicted Effect probably null
Transcript: ENSMUST00000060673
SMART Domains Protein: ENSMUSP00000062310
Gene: ENSMUSG00000044626

Pfam:Lipase 11 326 6.8e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000074230
SMART Domains Protein: ENSMUSP00000073853
Gene: ENSMUSG00000044626

Pfam:Lipase 15 214 1.5e-45 PFAM
Pfam:Abhydrolase_6 73 296 2.3e-6 PFAM
Pfam:Lipase 209 296 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231682
Predicted Effect probably null
Transcript: ENSMUST00000231766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232673
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation, smooth muscle contraction, and stimulation of cell proliferation and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit wavy vibrissae and wavy and matted coats associated with impaired inner rooth sheath formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T C 11: 3,894,987 D34G probably benign Het
Adam6a T C 12: 113,544,717 S237P probably damaging Het
Adamts13 A C 2: 26,981,080 D235A probably benign Het
Adgb T A 10: 10,357,879 M1259L probably benign Het
Apbb1 T C 7: 105,565,303 Q529R probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Camta1 T C 4: 151,586,431 T96A possibly damaging Het
Ccdc148 A T 2: 59,004,072 probably null Het
Cep170b T C 12: 112,736,806 Y568H probably damaging Het
Clca4b A T 3: 144,921,980 I410N probably damaging Het
Cnot10 G A 9: 114,598,770 T592I probably benign Het
Col6a3 C T 1: 90,828,049 A173T probably damaging Het
Ctcf T A 8: 105,676,157 C560* probably null Het
Daglb G A 5: 143,487,196 V369I probably benign Het
Defb19 G A 2: 152,580,226 L8F unknown Het
Emcn G T 3: 137,372,847 E65* probably null Het
Etl4 G T 2: 20,778,129 R753L probably damaging Het
Fam151b T C 13: 92,450,181 Y248C probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gjd4 A G 18: 9,280,964 V38A possibly damaging Het
Hivep1 T C 13: 42,158,379 V1365A possibly damaging Het
Hivep2 T C 10: 14,129,958 S767P possibly damaging Het
Hoxa6 T C 6: 52,206,568 T166A possibly damaging Het
Ift80 G T 3: 68,935,899 L367I probably benign Het
Igf2bp1 T C 11: 95,968,893 N369S possibly damaging Het
Igsf11 C A 16: 39,008,817 D24E probably benign Het
Ints5 C T 19: 8,895,750 L358F probably damaging Het
Kbtbd3 A G 9: 4,330,519 T298A possibly damaging Het
Kif28 C A 1: 179,731,253 V297F probably damaging Het
Krt12 T C 11: 99,417,945 Y422C probably damaging Het
Lig1 T A 7: 13,309,197 W856R probably damaging Het
Lrig3 T A 10: 126,013,448 C1012* probably null Het
Lrit1 A G 14: 37,060,225 E285G probably damaging Het
Lrrc31 A G 3: 30,689,228 V196A probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Mllt10 T C 2: 18,162,613 Y372H probably damaging Het
Mrpl50 A T 4: 49,514,515 V52E probably damaging Het
Mthfd1l T C 10: 4,056,766 V676A probably damaging Het
Ncl C T 1: 86,356,640 D245N possibly damaging Het
Neil1 A T 9: 57,146,781 probably null Het
Nfatc3 A G 8: 106,092,195 E515G probably damaging Het
Nlrp4b A G 7: 10,715,181 E70G possibly damaging Het
Nme3 A T 17: 24,896,517 I2F possibly damaging Het
Nup210 G A 6: 91,074,310 H364Y probably benign Het
Nxpe3 T A 16: 55,866,535 T37S probably benign Het
Olfm1 T A 2: 28,212,542 M76K probably benign Het
Pgbd5 A T 8: 124,434,032 V32E probably damaging Het
Plcb4 T C 2: 135,968,419 M646T probably damaging Het
Plekha7 G A 7: 116,158,020 P565L probably damaging Het
Poc5 A G 13: 96,398,866 D213G probably null Het
Poli A G 18: 70,523,381 I125T probably benign Het
Ppm1f T C 16: 16,903,390 M1T probably null Het
Psmd7 T C 8: 107,580,891 K320R unknown Het
Rabggtb A G 3: 153,910,317 V128A probably damaging Het
Rasa2 A T 9: 96,571,959 L308H probably damaging Het
Serpina1d C T 12: 103,763,775 V383M probably benign Het
Sipa1l1 T C 12: 82,384,756 probably null Het
Sos1 T C 17: 80,408,311 T1006A probably benign Het
Sugp1 T A 8: 70,070,008 Y453N probably damaging Het
Taf3 A T 2: 10,042,644 D64E probably benign Het
Tcf19 A T 17: 35,515,904 probably null Het
Trim60 T A 8: 65,001,216 H127L probably damaging Het
Tubb4a C T 17: 57,080,770 V419M probably damaging Het
Vmn2r22 G T 6: 123,637,725 T302K probably damaging Het
Vmn2r68 T G 7: 85,221,676 T800P possibly damaging Het
Zfhx2 A C 14: 55,063,508 V2262G probably damaging Het
Other mutations in Liph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Liph APN 16 21968140 missense probably damaging 1.00
babyback UTSW 16 21983957 missense probably damaging 0.97
PIT4131001:Liph UTSW 16 21995369 start codon destroyed probably null 0.59
R0004:Liph UTSW 16 21984194 nonsense probably null
R0045:Liph UTSW 16 21968053 missense probably damaging 1.00
R0045:Liph UTSW 16 21968053 missense probably damaging 1.00
R0689:Liph UTSW 16 21968068 missense probably damaging 1.00
R0715:Liph UTSW 16 21995350 missense probably benign 0.05
R1104:Liph UTSW 16 21984148 missense possibly damaging 0.82
R1779:Liph UTSW 16 21968050 missense probably benign 0.01
R2323:Liph UTSW 16 21984004 missense probably damaging 0.99
R3913:Liph UTSW 16 21962259 splice site probably benign
R4402:Liph UTSW 16 21976250 missense probably damaging 1.00
R4454:Liph UTSW 16 21984268 missense probably benign 0.11
R4672:Liph UTSW 16 21984056 missense probably benign 0.14
R4681:Liph UTSW 16 21984027 missense probably benign 0.02
R5111:Liph UTSW 16 21984070 missense probably damaging 1.00
R5135:Liph UTSW 16 21956165 nonsense probably null
R5235:Liph UTSW 16 21984035 missense probably damaging 1.00
R5642:Liph UTSW 16 21965995 missense possibly damaging 0.61
R5810:Liph UTSW 16 21968110 missense probably damaging 1.00
R6188:Liph UTSW 16 21984268 missense probably benign 0.11
R6557:Liph UTSW 16 21983920 missense possibly damaging 0.60
R6734:Liph UTSW 16 21983957 missense probably damaging 0.97
R7011:Liph UTSW 16 21984097 missense probably damaging 0.98
R7038:Liph UTSW 16 21976259 missense probably damaging 1.00
R7178:Liph UTSW 16 21976328 missense probably damaging 1.00
R7185:Liph UTSW 16 21995339 missense probably benign 0.00
R7198:Liph UTSW 16 21966022 missense probably damaging 1.00
R7775:Liph UTSW 16 21958914 missense probably damaging 1.00
R7832:Liph UTSW 16 21962236 missense probably benign 0.01
R7993:Liph UTSW 16 21958812 missense probably benign 0.03
R8264:Liph UTSW 16 21983971 missense possibly damaging 0.94
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gtacacacttataatacctgctactc -3'
Posted On2013-05-09