Incidental Mutation 'R0349:Fmn1'
ID 36046
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Name formin 1
Synonyms Fmn, formin-1
MMRRC Submission 038556-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock # R0349 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 113327736-113716767 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113365796 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 614 (I614V)
Ref Sequence ENSEMBL: ENSMUSP00000125052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
AlphaFold Q05860
Predicted Effect unknown
Transcript: ENSMUST00000099576
AA Change: I614V
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: I614V

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect unknown
Transcript: ENSMUST00000102547
AA Change: I614V
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: I614V

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110954
Predicted Effect unknown
Transcript: ENSMUST00000161731
AA Change: I614V
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: I614V

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
A1cf A T 19: 31,932,662 S285C possibly damaging Het
Abcc9 A T 6: 142,664,625 N604K probably benign Het
Adgrl3 A G 5: 81,771,644 T1192A probably damaging Het
Aldh1l2 A T 10: 83,490,614 Y800N probably damaging Het
Ano3 A T 2: 110,661,487 V865D probably damaging Het
App A T 16: 85,013,680 L545Q probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
B3galnt2 T C 13: 13,991,474 V318A probably benign Het
BC005561 T C 5: 104,519,976 L788P possibly damaging Het
Clcn3 T A 8: 60,941,348 D49V possibly damaging Het
Clcn6 T A 4: 148,024,194 K126M possibly damaging Het
Cntln T A 4: 84,996,485 S510T probably damaging Het
Csk A C 9: 57,628,194 C290W probably damaging Het
Dmxl1 T A 18: 49,879,282 M1502K probably damaging Het
Dpy19l2 T A 9: 24,695,922 N81I possibly damaging Het
Dpyd T A 3: 118,917,099 C385* probably null Het
Dst G A 1: 34,199,553 V1765I probably benign Het
Eif5b A G 1: 38,032,366 S459G probably benign Het
Fam105a T A 15: 27,664,790 I27L probably benign Het
Fam83d A G 2: 158,779,848 I160V possibly damaging Het
Fat3 A G 9: 16,031,180 F1299L probably damaging Het
Fsd1l T A 4: 53,679,854 V184E probably damaging Het
Fyco1 A G 9: 123,797,662 V1328A probably damaging Het
Ganab T A 19: 8,911,652 N572K probably null Het
Gbp10 T A 5: 105,221,076 D299V possibly damaging Het
Gm13078 T G 4: 143,727,059 W246G probably benign Het
Gpr83 T G 9: 14,868,267 L205R probably damaging Het
Hapln2 G A 3: 88,023,629 P152S probably damaging Het
Htatip2 T C 7: 49,773,392 Y232H probably benign Het
Itga2b C T 11: 102,467,426 V158I probably damaging Het
Kansl3 T C 1: 36,351,783 D390G probably damaging Het
Kcnh2 T C 5: 24,351,237 D16G probably benign Het
Kctd8 A T 5: 69,341,010 F98I probably damaging Het
Kif21b A T 1: 136,149,311 E357V probably damaging Het
Kmt5c C T 7: 4,746,595 R371C probably damaging Het
Kndc1 T C 7: 139,910,304 F241L probably benign Het
Lrba A G 3: 86,540,005 D2052G probably damaging Het
Lsr T A 7: 30,959,273 I54F probably damaging Het
Matk G T 10: 81,258,494 L28F probably benign Het
Mdn1 T C 4: 32,750,318 L4429P probably damaging Het
Med29 CCTGCTGCTGCTGCTGC CCTGCTGCTGCTGC 7: 28,392,510 probably benign Het
Msln G T 17: 25,750,276 Q407K possibly damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Myof A G 19: 37,910,969 I1040T probably damaging Het
Nckap5 A G 1: 126,026,434 S794P probably benign Het
Nfkbiz C T 16: 55,818,991 probably null Het
Nr2c1 C T 10: 94,195,182 S535L probably damaging Het
Olfr1448 A T 19: 12,919,935 C125S probably damaging Het
Olfr665 A T 7: 104,880,992 D95V possibly damaging Het
Olfr747 G A 14: 50,681,254 R127C probably benign Het
Opn3 A C 1: 175,692,304 L78R probably damaging Het
Pcdhb9 A G 18: 37,402,579 N542S probably damaging Het
Pdc T A 1: 150,333,427 N220K probably benign Het
Pde6c A T 19: 38,162,349 N569Y probably damaging Het
Pgm2 A T 4: 99,963,617 K219M probably damaging Het
Pitpnb C T 5: 111,347,126 T99M possibly damaging Het
Pou6f2 T A 13: 18,152,004 Q71L probably damaging Het
Prkd1 C A 12: 50,366,356 L677F probably damaging Het
Ranbp17 T C 11: 33,500,689 I78V probably benign Het
Rnft2 T A 5: 118,201,385 K362M possibly damaging Het
Rprd1a T A 18: 24,506,847 E259V possibly damaging Het
Scara3 A T 14: 65,931,781 I129N probably damaging Het
Scgb1a1 A T 19: 9,085,389 probably null Het
Sec16b A T 1: 157,532,176 probably null Het
Slc18a1 A T 8: 69,072,101 M167K probably damaging Het
Slc6a15 C T 10: 103,418,225 A674V probably benign Het
Slc6a3 T C 13: 73,567,557 F437S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stag1 T A 9: 100,776,784 N141K probably damaging Het
Sun2 T C 15: 79,730,232 E321G probably damaging Het
Taar2 C A 10: 23,941,429 T289K possibly damaging Het
Taar2 T C 10: 23,941,509 Y316H probably benign Het
Tbcd T A 11: 121,602,983 probably null Het
Tecr G A 8: 83,572,275 T106I probably damaging Het
Tmem60 T G 5: 20,886,630 V131G probably benign Het
Uimc1 A G 13: 55,075,991 V156A probably benign Het
Usp28 G A 9: 49,010,281 W266* probably null Het
Vmn2r17 T A 5: 109,428,336 S358T probably damaging Het
Wwc2 T A 8: 47,868,666 Y471F unknown Het
Ythdc1 C T 5: 86,835,720 R675C probably damaging Het
Zfp30 T C 7: 29,793,604 S428P probably damaging Het
Zfp462 T A 4: 55,008,768 C245S probably benign Het
Zscan30 T C 18: 23,971,398 noncoding transcript Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7440:Fmn1 UTSW 2 113441611 missense unknown
R7441:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
R7526:Fmn1 UTSW 2 113688134 missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113529310 splice site probably null
R7576:Fmn1 UTSW 2 113365008 missense unknown
R7657:Fmn1 UTSW 2 113525193 missense unknown
R7669:Fmn1 UTSW 2 113365477 missense unknown
R7713:Fmn1 UTSW 2 113525814 missense unknown
R7841:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R7953:Fmn1 UTSW 2 113596344 missense probably benign 0.03
R7959:Fmn1 UTSW 2 113365622 missense unknown
R8041:Fmn1 UTSW 2 113364594 missense unknown
R8152:Fmn1 UTSW 2 113365692 missense unknown
R8203:Fmn1 UTSW 2 113525275 missense unknown
R8318:Fmn1 UTSW 2 113365157 missense unknown
R8356:Fmn1 UTSW 2 113365040 missense unknown
R8456:Fmn1 UTSW 2 113365040 missense unknown
R8698:Fmn1 UTSW 2 113429807 missense unknown
R8861:Fmn1 UTSW 2 113364804 missense unknown
R8907:Fmn1 UTSW 2 113525569 missense unknown
R9147:Fmn1 UTSW 2 113441628 missense unknown
R9148:Fmn1 UTSW 2 113441628 missense unknown
R9536:Fmn1 UTSW 2 113478917 missense unknown
R9574:Fmn1 UTSW 2 113595057 missense probably damaging 1.00
R9577:Fmn1 UTSW 2 113364125 missense unknown
RF003:Fmn1 UTSW 2 113525786 small insertion probably benign
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGCGATGAGAAGAAGCCAACCC -3'
(R):5'- TGTTACTGACTGAATGACACAGCCC -3'

Sequencing Primer
(F):5'- AGGTTCCAACAGCTCTTGGC -3'
(R):5'- CTAGGAGGTTCAGTCCATTGTG -3'
Posted On 2013-05-09