Incidental Mutation 'R0349:Zfp462'
ID 36054
Institutional Source Beutler Lab
Gene Symbol Zfp462
Ensembl Gene ENSMUSG00000060206
Gene Name zinc finger protein 462
Synonyms 9430078C22Rik, Zfpip, Gt4-2
MMRRC Submission 038556-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.884) question?
Stock # R0349 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 54945048-55083563 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55008768 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 245 (C245S)
Ref Sequence ENSEMBL: ENSMUSP00000095677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030131] [ENSMUST00000079605] [ENSMUST00000098070] [ENSMUST00000133895]
AlphaFold B1AWL2
Predicted Effect probably benign
Transcript: ENSMUST00000030131
SMART Domains Protein: ENSMUSP00000030131
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 892 914 3.11e-2 SMART
ZnF_C2H2 926 948 4.11e-2 SMART
ZnF_C2H2 955 978 4.98e-1 SMART
ZnF_C2H2 984 1007 5.5e-3 SMART
ZnF_C2H2 1092 1115 7.05e-1 SMART
ZnF_C2H2 1121 1144 5.48e0 SMART
ZnF_C2H2 1155 1177 6.13e-1 SMART
ZnF_C2H2 1201 1223 1.26e-2 SMART
ZnF_C2H2 1229 1252 2.02e-1 SMART
low complexity region 1273 1296 N/A INTRINSIC
ZnF_C2H2 1315 1337 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079605
SMART Domains Protein: ENSMUSP00000078555
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 893 915 3.11e-2 SMART
ZnF_C2H2 927 949 4.11e-2 SMART
ZnF_C2H2 956 979 4.98e-1 SMART
ZnF_C2H2 985 1008 5.5e-3 SMART
ZnF_C2H2 1093 1116 7.05e-1 SMART
ZnF_C2H2 1122 1145 5.48e0 SMART
ZnF_C2H2 1156 1178 6.13e-1 SMART
ZnF_C2H2 1202 1224 1.26e-2 SMART
ZnF_C2H2 1230 1253 2.02e-1 SMART
low complexity region 1274 1297 N/A INTRINSIC
ZnF_C2H2 1316 1338 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098070
AA Change: C245S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095677
Gene: ENSMUSG00000060206
AA Change: C245S

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 94 N/A INTRINSIC
ZnF_C2H2 108 131 1.79e-2 SMART
ZnF_C2H2 162 185 4.65e-1 SMART
low complexity region 194 215 N/A INTRINSIC
ZnF_C2H2 243 266 4.98e-1 SMART
low complexity region 332 343 N/A INTRINSIC
ZnF_C2H2 440 463 1.01e-1 SMART
ZnF_C2H2 471 493 2.86e-1 SMART
low complexity region 503 515 N/A INTRINSIC
low complexity region 536 592 N/A INTRINSIC
ZnF_C2H2 593 616 2.53e-2 SMART
low complexity region 707 736 N/A INTRINSIC
ZnF_C2H2 835 858 5.62e0 SMART
ZnF_C2H2 878 900 2.14e0 SMART
ZnF_C2H2 917 940 6.67e-2 SMART
ZnF_C2H2 1023 1046 5.72e-1 SMART
low complexity region 1092 1100 N/A INTRINSIC
ZnF_C2H2 1107 1130 4.23e0 SMART
ZnF_C2H2 1183 1206 4.81e0 SMART
ZnF_C2H2 1254 1277 6.67e-2 SMART
ZnF_C2H2 1301 1324 3.47e0 SMART
ZnF_C2H2 1358 1381 7.29e0 SMART
ZnF_C2H2 1459 1482 2.17e-1 SMART
ZnF_C2H2 1504 1527 6.57e0 SMART
ZnF_C2H2 1566 1589 5.34e-1 SMART
low complexity region 1598 1611 N/A INTRINSIC
ZnF_C2H2 1649 1672 8.22e-2 SMART
ZnF_C2H2 1686 1709 5.34e0 SMART
ZnF_C2H2 1756 1779 6.4e0 SMART
low complexity region 1803 1824 N/A INTRINSIC
ZnF_C2H2 1835 1859 3.05e1 SMART
ZnF_C2H2 1881 1903 1.08e-1 SMART
low complexity region 1905 1919 N/A INTRINSIC
ZnF_C2H2 1957 1979 1.51e0 SMART
ZnF_C2H2 2014 2036 4.11e-2 SMART
ZnF_C2H2 2043 2066 4.98e-1 SMART
ZnF_C2H2 2072 2095 5.5e-3 SMART
ZnF_C2H2 2180 2203 7.05e-1 SMART
ZnF_C2H2 2209 2232 5.48e0 SMART
ZnF_C2H2 2243 2265 6.13e-1 SMART
ZnF_C2H2 2289 2311 1.26e-2 SMART
ZnF_C2H2 2317 2340 2.02e-1 SMART
low complexity region 2361 2384 N/A INTRINSIC
ZnF_C2H2 2403 2425 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133895
SMART Domains Protein: ENSMUSP00000122775
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to C2H2-type zinc finger family of proteins. It contains multiple C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,910,062 (GRCm39) S285C possibly damaging Het
Abcc9 A T 6: 142,610,351 (GRCm39) N604K probably benign Het
Acsbg3 T A 17: 57,192,169 (GRCm39) Y577* probably null Het
Adgrl3 A G 5: 81,919,491 (GRCm39) T1192A probably damaging Het
Aldh1l2 A T 10: 83,326,478 (GRCm39) Y800N probably damaging Het
Ano3 A T 2: 110,491,832 (GRCm39) V865D probably damaging Het
App A T 16: 84,810,568 (GRCm39) L545Q probably damaging Het
Atp10a A G 7: 58,453,215 (GRCm39) D798G probably damaging Het
B3galnt2 T C 13: 14,166,059 (GRCm39) V318A probably benign Het
Clcn3 T A 8: 61,394,382 (GRCm39) D49V possibly damaging Het
Clcn6 T A 4: 148,108,651 (GRCm39) K126M possibly damaging Het
Cntln T A 4: 84,914,722 (GRCm39) S510T probably damaging Het
Csk A C 9: 57,535,477 (GRCm39) C290W probably damaging Het
Dmxl1 T A 18: 50,012,349 (GRCm39) M1502K probably damaging Het
Dpy19l2 T A 9: 24,607,218 (GRCm39) N81I possibly damaging Het
Dpyd T A 3: 118,710,748 (GRCm39) C385* probably null Het
Dst G A 1: 34,238,634 (GRCm39) V1765I probably benign Het
Eif5b A G 1: 38,071,447 (GRCm39) S459G probably benign Het
Fam83d A G 2: 158,621,768 (GRCm39) I160V possibly damaging Het
Fat3 A G 9: 15,942,476 (GRCm39) F1299L probably damaging Het
Fmn1 A G 2: 113,196,141 (GRCm39) I614V unknown Het
Fsd1l T A 4: 53,679,854 (GRCm39) V184E probably damaging Het
Fyco1 A G 9: 123,626,727 (GRCm39) V1328A probably damaging Het
Ganab T A 19: 8,889,016 (GRCm39) N572K probably null Het
Gbp10 T A 5: 105,368,942 (GRCm39) D299V possibly damaging Het
Gpr83 T G 9: 14,779,563 (GRCm39) L205R probably damaging Het
Hapln2 G A 3: 87,930,936 (GRCm39) P152S probably damaging Het
Htatip2 T C 7: 49,423,140 (GRCm39) Y232H probably benign Het
Itga2b C T 11: 102,358,252 (GRCm39) V158I probably damaging Het
Kansl3 T C 1: 36,390,864 (GRCm39) D390G probably damaging Het
Kcnh2 T C 5: 24,556,235 (GRCm39) D16G probably benign Het
Kctd8 A T 5: 69,498,353 (GRCm39) F98I probably damaging Het
Kif21b A T 1: 136,077,049 (GRCm39) E357V probably damaging Het
Kmt5c C T 7: 4,749,594 (GRCm39) R371C probably damaging Het
Kndc1 T C 7: 139,490,220 (GRCm39) F241L probably benign Het
Lrba A G 3: 86,447,312 (GRCm39) D2052G probably damaging Het
Lsr T A 7: 30,658,698 (GRCm39) I54F probably damaging Het
Matk G T 10: 81,094,328 (GRCm39) L28F probably benign Het
Mdn1 T C 4: 32,750,318 (GRCm39) L4429P probably damaging Het
Med29 CCTGCTGCTGCTGCTGC CCTGCTGCTGCTGC 7: 28,091,935 (GRCm39) probably benign Het
Msln G T 17: 25,969,250 (GRCm39) Q407K possibly damaging Het
Msr1 C T 8: 40,034,868 (GRCm39) G428R probably damaging Het
Myof A G 19: 37,899,417 (GRCm39) I1040T probably damaging Het
Nckap5 A G 1: 125,954,171 (GRCm39) S794P probably benign Het
Nfkbiz C T 16: 55,639,354 (GRCm39) probably null Het
Nr2c1 C T 10: 94,031,044 (GRCm39) S535L probably damaging Het
Opn3 A C 1: 175,519,870 (GRCm39) L78R probably damaging Het
Or11h4b G A 14: 50,918,711 (GRCm39) R127C probably benign Het
Or52n3 A T 7: 104,530,199 (GRCm39) D95V possibly damaging Het
Or5b12 A T 19: 12,897,299 (GRCm39) C125S probably damaging Het
Otulinl T A 15: 27,664,876 (GRCm39) I27L probably benign Het
Pcdhb9 A G 18: 37,535,632 (GRCm39) N542S probably damaging Het
Pdc T A 1: 150,209,178 (GRCm39) N220K probably benign Het
Pde6c A T 19: 38,150,797 (GRCm39) N569Y probably damaging Het
Pgm1 A T 4: 99,820,814 (GRCm39) K219M probably damaging Het
Pitpnb C T 5: 111,494,992 (GRCm39) T99M possibly damaging Het
Pou6f2 T A 13: 18,326,589 (GRCm39) Q71L probably damaging Het
Pramel24 T G 4: 143,453,629 (GRCm39) W246G probably benign Het
Prkd1 C A 12: 50,413,139 (GRCm39) L677F probably damaging Het
Ranbp17 T C 11: 33,450,689 (GRCm39) I78V probably benign Het
Rnft2 T A 5: 118,339,450 (GRCm39) K362M possibly damaging Het
Rprd1a T A 18: 24,639,904 (GRCm39) E259V possibly damaging Het
Scara3 A T 14: 66,169,230 (GRCm39) I129N probably damaging Het
Scgb1a1 A T 19: 9,062,753 (GRCm39) probably null Het
Sec16b A T 1: 157,359,746 (GRCm39) probably null Het
Slc18a1 A T 8: 69,524,753 (GRCm39) M167K probably damaging Het
Slc6a15 C T 10: 103,254,086 (GRCm39) A674V probably benign Het
Slc6a3 T C 13: 73,715,676 (GRCm39) F437S probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Stag1 T A 9: 100,658,837 (GRCm39) N141K probably damaging Het
Sun2 T C 15: 79,614,433 (GRCm39) E321G probably damaging Het
Taar2 C A 10: 23,817,327 (GRCm39) T289K possibly damaging Het
Taar2 T C 10: 23,817,407 (GRCm39) Y316H probably benign Het
Tbcd T A 11: 121,493,809 (GRCm39) probably null Het
Tecr G A 8: 84,298,904 (GRCm39) T106I probably damaging Het
Thoc2l T C 5: 104,667,842 (GRCm39) L788P possibly damaging Het
Tmem60 T G 5: 21,091,628 (GRCm39) V131G probably benign Het
Uimc1 A G 13: 55,223,804 (GRCm39) V156A probably benign Het
Usp28 G A 9: 48,921,581 (GRCm39) W266* probably null Het
Vmn2r17 T A 5: 109,576,202 (GRCm39) S358T probably damaging Het
Wwc2 T A 8: 48,321,701 (GRCm39) Y471F unknown Het
Ythdc1 C T 5: 86,983,579 (GRCm39) R675C probably damaging Het
Zfp30 T C 7: 29,493,029 (GRCm39) S428P probably damaging Het
Zscan30 T C 18: 24,104,455 (GRCm39) noncoding transcript Het
Other mutations in Zfp462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfp462 APN 4 55,011,483 (GRCm39) splice site probably null
IGL00421:Zfp462 APN 4 55,023,576 (GRCm39) missense probably benign 0.00
IGL00899:Zfp462 APN 4 55,007,732 (GRCm39) missense probably damaging 1.00
IGL01549:Zfp462 APN 4 55,013,181 (GRCm39) missense probably damaging 1.00
IGL01627:Zfp462 APN 4 55,008,912 (GRCm39) missense possibly damaging 0.93
IGL01715:Zfp462 APN 4 55,008,586 (GRCm39) missense probably benign 0.20
IGL01862:Zfp462 APN 4 55,023,441 (GRCm39) missense probably damaging 1.00
IGL01878:Zfp462 APN 4 55,010,613 (GRCm39) missense probably damaging 1.00
IGL01913:Zfp462 APN 4 55,012,138 (GRCm39) missense probably benign 0.04
IGL02029:Zfp462 APN 4 55,079,395 (GRCm39) splice site probably benign
IGL02338:Zfp462 APN 4 55,010,292 (GRCm39) missense possibly damaging 0.88
IGL02552:Zfp462 APN 4 55,010,613 (GRCm39) missense probably damaging 1.00
IGL02623:Zfp462 APN 4 55,012,986 (GRCm39) missense probably damaging 1.00
IGL02750:Zfp462 APN 4 55,060,236 (GRCm39) missense probably null 1.00
IGL02815:Zfp462 APN 4 55,051,303 (GRCm39) missense probably damaging 1.00
IGL03204:Zfp462 APN 4 55,080,785 (GRCm39) missense possibly damaging 0.80
FR4304:Zfp462 UTSW 4 55,009,758 (GRCm39) unclassified probably benign
FR4304:Zfp462 UTSW 4 55,009,757 (GRCm39) unclassified probably benign
FR4737:Zfp462 UTSW 4 55,009,760 (GRCm39) unclassified probably benign
FR4737:Zfp462 UTSW 4 55,009,758 (GRCm39) unclassified probably benign
FR4976:Zfp462 UTSW 4 55,009,761 (GRCm39) unclassified probably benign
FR4976:Zfp462 UTSW 4 55,009,760 (GRCm39) unclassified probably benign
P0035:Zfp462 UTSW 4 55,009,086 (GRCm39) missense probably benign
R0052:Zfp462 UTSW 4 55,011,762 (GRCm39) missense probably benign 0.03
R0143:Zfp462 UTSW 4 55,023,402 (GRCm39) splice site probably benign
R0145:Zfp462 UTSW 4 55,010,529 (GRCm39) missense probably damaging 1.00
R0315:Zfp462 UTSW 4 55,079,314 (GRCm39) missense probably damaging 0.99
R0359:Zfp462 UTSW 4 55,013,689 (GRCm39) missense probably damaging 1.00
R0413:Zfp462 UTSW 4 55,010,534 (GRCm39) missense probably damaging 0.99
R0554:Zfp462 UTSW 4 55,013,689 (GRCm39) missense probably damaging 1.00
R0616:Zfp462 UTSW 4 55,011,951 (GRCm39) missense probably damaging 1.00
R0631:Zfp462 UTSW 4 55,007,563 (GRCm39) start codon destroyed possibly damaging 0.60
R1086:Zfp462 UTSW 4 55,013,000 (GRCm39) missense probably damaging 1.00
R1499:Zfp462 UTSW 4 55,060,046 (GRCm39) missense probably damaging 1.00
R1509:Zfp462 UTSW 4 55,007,667 (GRCm39) missense probably damaging 1.00
R1526:Zfp462 UTSW 4 55,009,002 (GRCm39) missense probably benign
R1541:Zfp462 UTSW 4 55,008,928 (GRCm39) missense possibly damaging 0.53
R1691:Zfp462 UTSW 4 55,013,489 (GRCm39) missense possibly damaging 0.70
R1843:Zfp462 UTSW 4 55,010,010 (GRCm39) missense possibly damaging 0.88
R2086:Zfp462 UTSW 4 55,010,830 (GRCm39) missense probably damaging 1.00
R2109:Zfp462 UTSW 4 55,008,496 (GRCm39) missense probably benign 0.00
R2148:Zfp462 UTSW 4 55,013,670 (GRCm39) missense probably benign 0.01
R2179:Zfp462 UTSW 4 55,009,524 (GRCm39) missense possibly damaging 0.73
R2325:Zfp462 UTSW 4 55,013,712 (GRCm39) missense probably benign
R2352:Zfp462 UTSW 4 55,008,313 (GRCm39) missense probably null
R2566:Zfp462 UTSW 4 55,008,522 (GRCm39) missense probably benign 0.00
R3879:Zfp462 UTSW 4 55,060,095 (GRCm39) missense probably damaging 1.00
R3969:Zfp462 UTSW 4 55,012,402 (GRCm39) missense probably damaging 1.00
R4273:Zfp462 UTSW 4 55,008,411 (GRCm39) missense probably benign 0.00
R4413:Zfp462 UTSW 4 55,012,672 (GRCm39) missense probably damaging 0.99
R4510:Zfp462 UTSW 4 55,008,934 (GRCm39) missense possibly damaging 0.86
R4511:Zfp462 UTSW 4 55,008,934 (GRCm39) missense possibly damaging 0.86
R4609:Zfp462 UTSW 4 55,011,889 (GRCm39) missense probably damaging 1.00
R4632:Zfp462 UTSW 4 55,012,981 (GRCm39) missense probably damaging 1.00
R4649:Zfp462 UTSW 4 55,009,349 (GRCm39) missense probably benign
R4682:Zfp462 UTSW 4 55,011,376 (GRCm39) missense probably damaging 1.00
R4696:Zfp462 UTSW 4 55,008,612 (GRCm39) missense probably benign
R4744:Zfp462 UTSW 4 55,011,598 (GRCm39) missense probably damaging 1.00
R4747:Zfp462 UTSW 4 55,013,476 (GRCm39) missense probably benign 0.00
R4819:Zfp462 UTSW 4 55,060,044 (GRCm39) missense probably damaging 1.00
R4827:Zfp462 UTSW 4 55,012,213 (GRCm39) missense probably damaging 1.00
R4854:Zfp462 UTSW 4 55,010,668 (GRCm39) missense probably damaging 1.00
R4879:Zfp462 UTSW 4 55,009,444 (GRCm39) missense probably benign 0.02
R4891:Zfp462 UTSW 4 55,060,055 (GRCm39) missense probably damaging 1.00
R4993:Zfp462 UTSW 4 55,051,204 (GRCm39) missense possibly damaging 0.62
R5118:Zfp462 UTSW 4 55,010,667 (GRCm39) missense probably damaging 1.00
R5171:Zfp462 UTSW 4 55,016,986 (GRCm39) splice site probably null
R5173:Zfp462 UTSW 4 55,011,115 (GRCm39) missense probably damaging 0.99
R5221:Zfp462 UTSW 4 55,016,887 (GRCm39) missense possibly damaging 0.86
R5268:Zfp462 UTSW 4 55,012,299 (GRCm39) missense probably benign
R5314:Zfp462 UTSW 4 55,013,178 (GRCm39) missense probably damaging 1.00
R5429:Zfp462 UTSW 4 55,060,077 (GRCm39) missense probably damaging 1.00
R5518:Zfp462 UTSW 4 55,009,818 (GRCm39) missense probably damaging 0.99
R5525:Zfp462 UTSW 4 55,050,281 (GRCm39) missense possibly damaging 0.73
R5620:Zfp462 UTSW 4 55,013,464 (GRCm39) missense probably benign 0.01
R5775:Zfp462 UTSW 4 55,010,590 (GRCm39) missense probably damaging 0.99
R6126:Zfp462 UTSW 4 55,023,573 (GRCm39) missense probably benign 0.01
R6280:Zfp462 UTSW 4 55,010,253 (GRCm39) missense probably benign 0.00
R6325:Zfp462 UTSW 4 55,080,680 (GRCm39) missense probably benign 0.04
R6542:Zfp462 UTSW 4 55,023,433 (GRCm39) missense probably damaging 1.00
R6612:Zfp462 UTSW 4 55,012,324 (GRCm39) splice site probably null
R6663:Zfp462 UTSW 4 55,008,933 (GRCm39) missense possibly damaging 0.53
R6872:Zfp462 UTSW 4 55,012,326 (GRCm39) missense probably benign 0.01
R6889:Zfp462 UTSW 4 55,007,671 (GRCm39) missense probably damaging 1.00
R6896:Zfp462 UTSW 4 55,009,544 (GRCm39) missense possibly damaging 0.72
R6913:Zfp462 UTSW 4 55,007,775 (GRCm39) missense probably benign 0.25
R6988:Zfp462 UTSW 4 55,080,716 (GRCm39) missense probably benign 0.00
R7131:Zfp462 UTSW 4 55,009,380 (GRCm39) missense probably benign
R7151:Zfp462 UTSW 4 55,051,271 (GRCm39) missense probably damaging 0.99
R7684:Zfp462 UTSW 4 55,008,908 (GRCm39) missense probably benign
R7741:Zfp462 UTSW 4 55,008,637 (GRCm39) missense probably benign 0.00
R7750:Zfp462 UTSW 4 55,016,958 (GRCm39) missense probably benign 0.06
R7812:Zfp462 UTSW 4 55,008,509 (GRCm39) missense probably benign 0.00
R7863:Zfp462 UTSW 4 55,007,747 (GRCm39) missense probably benign
R7898:Zfp462 UTSW 4 55,012,995 (GRCm39) missense probably damaging 0.98
R7993:Zfp462 UTSW 4 55,011,907 (GRCm39) missense probably damaging 1.00
R7995:Zfp462 UTSW 4 55,011,907 (GRCm39) missense probably damaging 1.00
R8023:Zfp462 UTSW 4 55,073,106 (GRCm39) critical splice donor site probably null
R8394:Zfp462 UTSW 4 55,011,862 (GRCm39) missense probably damaging 1.00
R8669:Zfp462 UTSW 4 55,051,313 (GRCm39) missense probably damaging 0.99
R8877:Zfp462 UTSW 4 55,011,097 (GRCm39) missense probably damaging 0.98
R8980:Zfp462 UTSW 4 55,009,681 (GRCm39) unclassified probably benign
R9023:Zfp462 UTSW 4 55,007,563 (GRCm39) start codon destroyed probably null 0.00
R9243:Zfp462 UTSW 4 55,009,595 (GRCm39) nonsense probably null
R9378:Zfp462 UTSW 4 55,011,510 (GRCm39) missense probably benign 0.00
R9417:Zfp462 UTSW 4 55,016,988 (GRCm39) missense probably benign 0.26
R9476:Zfp462 UTSW 4 55,080,735 (GRCm39) missense probably benign
R9510:Zfp462 UTSW 4 55,080,735 (GRCm39) missense probably benign
R9610:Zfp462 UTSW 4 55,009,545 (GRCm39) missense possibly damaging 0.73
R9628:Zfp462 UTSW 4 55,009,423 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AACAGTCTGAAGGAGTCCACAGCG -3'
(R):5'- ATGGAGCCCCTGAAATTGGAGACG -3'

Sequencing Primer
(F):5'- GAGTCCACAGCGCCACC -3'
(R):5'- CATCTCCCGGCTCGCAG -3'
Posted On 2013-05-09