Incidental Mutation 'R0349:Adgrl3'
ID36064
Institutional Source Beutler Lab
Gene Symbol Adgrl3
Ensembl Gene ENSMUSG00000037605
Gene Nameadhesion G protein-coupled receptor L3
SynonymsLEC3, 5430402I23Rik, lectomedin 3, Lphn3, D130075K09Rik
MMRRC Submission 038556-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0349 (G1)
Quality Score224
Status Not validated
Chromosome5
Chromosomal Location81020138-81825133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81771644 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1192 (T1192A)
Ref Sequence ENSEMBL: ENSMUSP00000113208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036068] [ENSMUST00000072521] [ENSMUST00000117253] [ENSMUST00000117407] [ENSMUST00000117985] [ENSMUST00000118034] [ENSMUST00000118078] [ENSMUST00000118442] [ENSMUST00000119385] [ENSMUST00000119788] [ENSMUST00000120128] [ENSMUST00000120144] [ENSMUST00000120673] [ENSMUST00000120292] [ENSMUST00000120445] [ENSMUST00000121707] [ENSMUST00000122037] [ENSMUST00000121641] [ENSMUST00000122356] [ENSMUST00000132375]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036068
AA Change: T1260A

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045342
Gene: ENSMUSG00000037605
AA Change: T1260A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 6.6e-27 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 1.1e-7 PFAM
Pfam:DUF3497 627 857 2.2e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 4.4e-72 PFAM
Pfam:Latrophilin 1206 1276 2.4e-30 PFAM
Pfam:Latrophilin 1272 1543 3.2e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072521
AA Change: T1260A

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072336
Gene: ENSMUSG00000037605
AA Change: T1260A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 5.9e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.3e-8 PFAM
Pfam:GAIN 630 856 1.2e-58 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 2.5e-73 PFAM
Pfam:Latrophilin 1207 1274 4e-34 PFAM
Pfam:Latrophilin 1272 1543 5e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117253
AA Change: T1183A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112470
Gene: ENSMUSG00000037605
AA Change: T1183A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 5e-73 PFAM
Pfam:Latrophilin 1129 1265 7.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117407
AA Change: T1251A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112388
Gene: ENSMUSG00000037605
AA Change: T1251A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.4e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 6e-8 PFAM
Pfam:DUF3497 627 857 2.6e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 7.7e-73 PFAM
Pfam:Latrophilin 1197 1321 1.8e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117985
AA Change: T1192A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113950
Gene: ENSMUSG00000037605
AA Change: T1192A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.3e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.5e-8 PFAM
Pfam:DUF3497 559 789 1.6e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.7e-72 PFAM
Pfam:Latrophilin 1138 1512 6.8e-178 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118034
AA Change: T1183A

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113534
Gene: ENSMUSG00000037605
AA Change: T1183A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.2e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.5e-8 PFAM
Pfam:DUF3497 559 789 1.6e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 6.6e-73 PFAM
Pfam:Latrophilin 1129 1503 6.7e-178 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118078
AA Change: T1183A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112731
Gene: ENSMUSG00000037605
AA Change: T1183A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 9.7e-27 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.3e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 4.8e-73 PFAM
Pfam:Latrophilin 1129 1201 2.6e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118442
AA Change: T1260A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113836
Gene: ENSMUSG00000037605
AA Change: T1260A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.7e-8 PFAM
Pfam:DUF3497 627 857 1.3e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.4e-72 PFAM
Pfam:Latrophilin 1206 1278 2.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119385
AA Change: T1251A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113243
Gene: ENSMUSG00000037605
AA Change: T1251A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.6e-8 PFAM
Pfam:DUF3497 627 857 1.3e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 5.2e-73 PFAM
Pfam:Latrophilin 1197 1269 2.7e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119788
AA Change: T1260A

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114067
Gene: ENSMUSG00000037605
AA Change: T1260A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.7e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.8e-72 PFAM
Pfam:Latrophilin 1206 1279 3.6e-31 PFAM
Pfam:Latrophilin 1273 1550 4.5e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120128
AA Change: T1192A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113208
Gene: ENSMUSG00000037605
AA Change: T1192A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 9.8e-27 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.4e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.3e-72 PFAM
Pfam:Latrophilin 1138 1210 2.6e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120144
AA Change: T1183A

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113619
Gene: ENSMUSG00000037605
AA Change: T1183A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.3e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 5.1e-73 PFAM
Pfam:Latrophilin 1129 1253 8.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120673
AA Change: T1260A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113482
Gene: ENSMUSG00000037605
AA Change: T1260A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.7e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 3.3e-8 PFAM
Pfam:GAIN 630 856 6.4e-59 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.8e-73 PFAM
Pfam:Latrophilin 1207 1580 1.4e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120292
AA Change: T1192A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112548
Gene: ENSMUSG00000037605
AA Change: T1192A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.3e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.3e-72 PFAM
Pfam:Latrophilin 1138 1262 8.5e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120445
AA Change: T1260A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113249
Gene: ENSMUSG00000037605
AA Change: T1260A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.2e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 2.8e-8 PFAM
Pfam:GAIN 630 856 5.1e-59 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.4e-73 PFAM
Pfam:Latrophilin 1207 1328 8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121707
AA Change: T1251A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112823
Gene: ENSMUSG00000037605
AA Change: T1251A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.6e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 6.8e-73 PFAM
Pfam:Latrophilin 1197 1267 6.4e-30 PFAM
Pfam:Latrophilin 1263 1534 8.7e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122037
AA Change: T1183A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113374
Gene: ENSMUSG00000037605
AA Change: T1183A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.2e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.3e-8 PFAM
Pfam:DUF3497 559 789 1.5e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 6.3e-73 PFAM
Pfam:Latrophilin 1129 1199 4.4e-30 PFAM
Pfam:Latrophilin 1194 1460 1.3e-112 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121641
AA Change: T1251A

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113694
Gene: ENSMUSG00000037605
AA Change: T1251A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.8e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 7e-73 PFAM
Pfam:Latrophilin 1197 1571 7.3e-178 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124117
AA Change: T595A
SMART Domains Protein: ENSMUSP00000118882
Gene: ENSMUSG00000037605
AA Change: T595A

DomainStartEndE-ValueType
Pfam:GAIN 2 201 1.8e-51 PFAM
GPS 227 279 3.72e-25 SMART
Pfam:7tm_2 287 523 9.1e-75 PFAM
Pfam:Latrophilin 543 610 7.2e-35 PFAM
Pfam:Latrophilin 607 873 1.8e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122356
AA Change: T1251A

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113600
Gene: ENSMUSG00000037605
AA Change: T1251A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.8e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 7e-8 PFAM
Pfam:DUF3497 627 857 3.1e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 9.3e-73 PFAM
Pfam:Latrophilin 1197 1267 9e-30 PFAM
Pfam:Latrophilin 1262 1528 2.8e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153264
Predicted Effect probably benign
Transcript: ENSMUST00000132375
SMART Domains Protein: ENSMUSP00000117211
Gene: ENSMUSG00000037605

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased dopamine and serotonine levels in the dorsal striatum, hyperactivity, increased stereotypic behavior and enhanced hyperactivity in response to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
A1cf A T 19: 31,932,662 S285C possibly damaging Het
Abcc9 A T 6: 142,664,625 N604K probably benign Het
Aldh1l2 A T 10: 83,490,614 Y800N probably damaging Het
Ano3 A T 2: 110,661,487 V865D probably damaging Het
App A T 16: 85,013,680 L545Q probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
B3galnt2 T C 13: 13,991,474 V318A probably benign Het
BC005561 T C 5: 104,519,976 L788P possibly damaging Het
Clcn3 T A 8: 60,941,348 D49V possibly damaging Het
Clcn6 T A 4: 148,024,194 K126M possibly damaging Het
Cntln T A 4: 84,996,485 S510T probably damaging Het
Csk A C 9: 57,628,194 C290W probably damaging Het
Dmxl1 T A 18: 49,879,282 M1502K probably damaging Het
Dpy19l2 T A 9: 24,695,922 N81I possibly damaging Het
Dpyd T A 3: 118,917,099 C385* probably null Het
Dst G A 1: 34,199,553 V1765I probably benign Het
Eif5b A G 1: 38,032,366 S459G probably benign Het
Fam105a T A 15: 27,664,790 I27L probably benign Het
Fam83d A G 2: 158,779,848 I160V possibly damaging Het
Fat3 A G 9: 16,031,180 F1299L probably damaging Het
Fmn1 A G 2: 113,365,796 I614V unknown Het
Fsd1l T A 4: 53,679,854 V184E probably damaging Het
Fyco1 A G 9: 123,797,662 V1328A probably damaging Het
Ganab T A 19: 8,911,652 N572K probably null Het
Gbp10 T A 5: 105,221,076 D299V possibly damaging Het
Gm13078 T G 4: 143,727,059 W246G probably benign Het
Gpr83 T G 9: 14,868,267 L205R probably damaging Het
Hapln2 G A 3: 88,023,629 P152S probably damaging Het
Htatip2 T C 7: 49,773,392 Y232H probably benign Het
Itga2b C T 11: 102,467,426 V158I probably damaging Het
Kansl3 T C 1: 36,351,783 D390G probably damaging Het
Kcnh2 T C 5: 24,351,237 D16G probably benign Het
Kctd8 A T 5: 69,341,010 F98I probably damaging Het
Kif21b A T 1: 136,149,311 E357V probably damaging Het
Kmt5c C T 7: 4,746,595 R371C probably damaging Het
Kndc1 T C 7: 139,910,304 F241L probably benign Het
Lrba A G 3: 86,540,005 D2052G probably damaging Het
Lsr T A 7: 30,959,273 I54F probably damaging Het
Matk G T 10: 81,258,494 L28F probably benign Het
Mdn1 T C 4: 32,750,318 L4429P probably damaging Het
Med29 CCTGCTGCTGCTGCTGC CCTGCTGCTGCTGC 7: 28,392,510 probably benign Het
Msln G T 17: 25,750,276 Q407K possibly damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Myof A G 19: 37,910,969 I1040T probably damaging Het
Nckap5 A G 1: 126,026,434 S794P probably benign Het
Nfkbiz C T 16: 55,818,991 probably null Het
Nr2c1 C T 10: 94,195,182 S535L probably damaging Het
Olfr1448 A T 19: 12,919,935 C125S probably damaging Het
Olfr665 A T 7: 104,880,992 D95V possibly damaging Het
Olfr747 G A 14: 50,681,254 R127C probably benign Het
Opn3 A C 1: 175,692,304 L78R probably damaging Het
Pcdhb9 A G 18: 37,402,579 N542S probably damaging Het
Pdc T A 1: 150,333,427 N220K probably benign Het
Pde6c A T 19: 38,162,349 N569Y probably damaging Het
Pgm2 A T 4: 99,963,617 K219M probably damaging Het
Pitpnb C T 5: 111,347,126 T99M possibly damaging Het
Pou6f2 T A 13: 18,152,004 Q71L probably damaging Het
Prkd1 C A 12: 50,366,356 L677F probably damaging Het
Ranbp17 T C 11: 33,500,689 I78V probably benign Het
Rnft2 T A 5: 118,201,385 K362M possibly damaging Het
Rprd1a T A 18: 24,506,847 E259V possibly damaging Het
Scara3 A T 14: 65,931,781 I129N probably damaging Het
Scgb1a1 A T 19: 9,085,389 probably null Het
Sec16b A T 1: 157,532,176 probably null Het
Slc18a1 A T 8: 69,072,101 M167K probably damaging Het
Slc6a15 C T 10: 103,418,225 A674V probably benign Het
Slc6a3 T C 13: 73,567,557 F437S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stag1 T A 9: 100,776,784 N141K probably damaging Het
Sun2 T C 15: 79,730,232 E321G probably damaging Het
Taar2 C A 10: 23,941,429 T289K possibly damaging Het
Taar2 T C 10: 23,941,509 Y316H probably benign Het
Tbcd T A 11: 121,602,983 probably null Het
Tecr G A 8: 83,572,275 T106I probably damaging Het
Tmem60 T G 5: 20,886,630 V131G probably benign Het
Uimc1 A G 13: 55,075,991 V156A probably benign Het
Usp28 G A 9: 49,010,281 W266* probably null Het
Vmn2r17 T A 5: 109,428,336 S358T probably damaging Het
Wwc2 T A 8: 47,868,666 Y471F unknown Het
Ythdc1 C T 5: 86,835,720 R675C probably damaging Het
Zfp30 T C 7: 29,793,604 S428P probably damaging Het
Zfp462 T A 4: 55,008,768 C245S probably benign Het
Zscan30 T C 18: 23,971,398 noncoding transcript Het
Other mutations in Adgrl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Adgrl3 APN 5 81724224 missense probably damaging 0.99
IGL00596:Adgrl3 APN 5 81646467 missense probably benign 0.01
IGL00766:Adgrl3 APN 5 81794568 missense probably damaging 1.00
IGL00787:Adgrl3 APN 5 81693554 missense probably damaging 1.00
IGL00917:Adgrl3 APN 5 81693574 missense possibly damaging 0.93
IGL01155:Adgrl3 APN 5 81560893 missense probably benign 0.39
IGL01348:Adgrl3 APN 5 81726723 missense probably damaging 1.00
IGL01401:Adgrl3 APN 5 81688669 missense possibly damaging 0.94
IGL01443:Adgrl3 APN 5 81465287 missense probably damaging 1.00
IGL01532:Adgrl3 APN 5 81694569 missense probably damaging 1.00
IGL01779:Adgrl3 APN 5 81387870 missense probably damaging 1.00
IGL01920:Adgrl3 APN 5 81465296 missense probably damaging 1.00
IGL02065:Adgrl3 APN 5 81512217 missense probably damaging 1.00
IGL02365:Adgrl3 APN 5 81512581 missense probably damaging 1.00
IGL02879:Adgrl3 APN 5 81512119 missense probably damaging 1.00
R0010:Adgrl3 UTSW 5 81792403 missense possibly damaging 0.58
R0077:Adgrl3 UTSW 5 81771685 splice site probably benign
R0103:Adgrl3 UTSW 5 81792347 intron probably benign
R0138:Adgrl3 UTSW 5 81693607 missense probably damaging 1.00
R0149:Adgrl3 UTSW 5 81760697 missense probably damaging 1.00
R0361:Adgrl3 UTSW 5 81760697 missense probably damaging 1.00
R0522:Adgrl3 UTSW 5 81726801 missense possibly damaging 0.91
R0610:Adgrl3 UTSW 5 81693716 splice site probably benign
R0658:Adgrl3 UTSW 5 81648713 missense probably benign 0.18
R0671:Adgrl3 UTSW 5 81560905 missense probably benign 0.45
R0679:Adgrl3 UTSW 5 81794977 missense probably damaging 1.00
R1413:Adgrl3 UTSW 5 81693519 missense probably damaging 1.00
R1444:Adgrl3 UTSW 5 81512353 missense probably damaging 1.00
R1574:Adgrl3 UTSW 5 81787449 missense probably damaging 1.00
R1574:Adgrl3 UTSW 5 81787449 missense probably damaging 1.00
R1738:Adgrl3 UTSW 5 81387979 missense probably damaging 0.99
R1744:Adgrl3 UTSW 5 81794420 missense probably damaging 1.00
R1803:Adgrl3 UTSW 5 81771617 nonsense probably null
R1891:Adgrl3 UTSW 5 81512044 missense probably damaging 1.00
R1988:Adgrl3 UTSW 5 81688567 missense probably damaging 1.00
R2126:Adgrl3 UTSW 5 81512536 missense probably damaging 1.00
R2136:Adgrl3 UTSW 5 81512254 missense probably damaging 1.00
R2171:Adgrl3 UTSW 5 81512515 nonsense probably null
R2891:Adgrl3 UTSW 5 81693519 missense probably damaging 1.00
R3508:Adgrl3 UTSW 5 81724256 missense probably damaging 1.00
R3732:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3732:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3733:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3982:Adgrl3 UTSW 5 81694526 missense possibly damaging 0.95
R4085:Adgrl3 UTSW 5 81512544 missense probably benign 0.02
R4462:Adgrl3 UTSW 5 81688510 missense probably damaging 1.00
R4725:Adgrl3 UTSW 5 81766205 missense possibly damaging 0.67
R4726:Adgrl3 UTSW 5 81646578 missense possibly damaging 0.61
R4781:Adgrl3 UTSW 5 81760724 missense probably damaging 1.00
R4837:Adgrl3 UTSW 5 81766234 missense probably benign 0.07
R4841:Adgrl3 UTSW 5 81794271 missense possibly damaging 0.53
R4883:Adgrl3 UTSW 5 81689646 missense probably damaging 1.00
R4921:Adgrl3 UTSW 5 81512110 missense probably damaging 1.00
R4945:Adgrl3 UTSW 5 81512048 missense probably damaging 1.00
R5055:Adgrl3 UTSW 5 81646551 missense possibly damaging 0.48
R5313:Adgrl3 UTSW 5 81726669 missense probably damaging 1.00
R5385:Adgrl3 UTSW 5 81726801 missense probably damaging 1.00
R5447:Adgrl3 UTSW 5 81465341 intron probably benign
R5482:Adgrl3 UTSW 5 81794513 missense probably damaging 1.00
R5586:Adgrl3 UTSW 5 81724147 missense probably damaging 0.99
R5637:Adgrl3 UTSW 5 81693544 missense probably damaging 1.00
R5919:Adgrl3 UTSW 5 81646570 missense probably benign 0.00
R6090:Adgrl3 UTSW 5 81512326 missense probably damaging 1.00
R6093:Adgrl3 UTSW 5 81646522 missense probably benign 0.42
R6107:Adgrl3 UTSW 5 81688563 missense probably damaging 0.97
R6245:Adgrl3 UTSW 5 81688556 missense probably benign 0.01
R6426:Adgrl3 UTSW 5 81726870 missense probably damaging 1.00
R6440:Adgrl3 UTSW 5 81794494 nonsense probably null
R6516:Adgrl3 UTSW 5 81465272 missense probably damaging 1.00
R6527:Adgrl3 UTSW 5 81787517 missense probably damaging 0.99
R6622:Adgrl3 UTSW 5 81794759 missense probably benign 0.34
R6842:Adgrl3 UTSW 5 81741080 missense probably damaging 1.00
R6902:Adgrl3 UTSW 5 81689587 missense probably damaging 1.00
R6921:Adgrl3 UTSW 5 81648713 missense probably damaging 0.99
R7201:Adgrl3 UTSW 5 81724222 missense probably damaging 1.00
R7207:Adgrl3 UTSW 5 81310027 start codon destroyed probably null 0.33
R7215:Adgrl3 UTSW 5 81693550 missense probably damaging 1.00
R7376:Adgrl3 UTSW 5 81794750 missense probably damaging 1.00
R7441:Adgrl3 UTSW 5 81724140 missense possibly damaging 0.70
R7582:Adgrl3 UTSW 5 81693676 missense probably damaging 0.99
R7682:Adgrl3 UTSW 5 81794560 missense probably damaging 0.97
R7863:Adgrl3 UTSW 5 81512749 missense probably damaging 1.00
R7877:Adgrl3 UTSW 5 81694620 missense probably benign 0.30
R8051:Adgrl3 UTSW 5 81465266 missense probably damaging 1.00
R8237:Adgrl3 UTSW 5 81787561 frame shift probably null
R8390:Adgrl3 UTSW 5 81766210 missense probably damaging 1.00
R8392:Adgrl3 UTSW 5 81646550 missense probably benign 0.01
Z1088:Adgrl3 UTSW 5 81329882 missense probably benign 0.33
Z1088:Adgrl3 UTSW 5 81512158 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAACAGCCTCCTCTAGCTTTG -3'
(R):5'- AATTTTACCAGGCAGCATCCTCCC -3'

Sequencing Primer
(F):5'- CCTCCTCTAGCTTTGAGAGAAAC -3'
(R):5'- TTCATACCTGGGACAATTGGAGC -3'
Posted On2013-05-09