Incidental Mutation 'R0349:Gbp10'
ID36067
Institutional Source Beutler Lab
Gene Symbol Gbp10
Ensembl Gene ENSMUSG00000105096
Gene Nameguanylate-binding protein 10
Synonyms
MMRRC Submission 038556-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0349 (G1)
Quality Score212
Status Not validated
Chromosome5
Chromosomal Location105215699-105239533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105221076 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 299 (D299V)
Ref Sequence ENSEMBL: ENSMUSP00000069042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050011] [ENSMUST00000065588]
Predicted Effect probably benign
Transcript: ENSMUST00000050011
SMART Domains Protein: ENSMUSP00000062528
Gene: ENSMUSG00000079362

DomainStartEndE-ValueType
Pfam:GBP 16 279 7.6e-118 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000065588
AA Change: D299V

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069042
Gene: ENSMUSG00000105096
AA Change: D299V

DomainStartEndE-ValueType
Pfam:GBP 16 279 5e-115 PFAM
Pfam:GBP_C 281 575 3.6e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196634
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
A1cf A T 19: 31,932,662 S285C possibly damaging Het
Abcc9 A T 6: 142,664,625 N604K probably benign Het
Adgrl3 A G 5: 81,771,644 T1192A probably damaging Het
Aldh1l2 A T 10: 83,490,614 Y800N probably damaging Het
Ano3 A T 2: 110,661,487 V865D probably damaging Het
App A T 16: 85,013,680 L545Q probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
B3galnt2 T C 13: 13,991,474 V318A probably benign Het
BC005561 T C 5: 104,519,976 L788P possibly damaging Het
Clcn3 T A 8: 60,941,348 D49V possibly damaging Het
Clcn6 T A 4: 148,024,194 K126M possibly damaging Het
Cntln T A 4: 84,996,485 S510T probably damaging Het
Csk A C 9: 57,628,194 C290W probably damaging Het
Dmxl1 T A 18: 49,879,282 M1502K probably damaging Het
Dpy19l2 T A 9: 24,695,922 N81I possibly damaging Het
Dpyd T A 3: 118,917,099 C385* probably null Het
Dst G A 1: 34,199,553 V1765I probably benign Het
Eif5b A G 1: 38,032,366 S459G probably benign Het
Fam105a T A 15: 27,664,790 I27L probably benign Het
Fam83d A G 2: 158,779,848 I160V possibly damaging Het
Fat3 A G 9: 16,031,180 F1299L probably damaging Het
Fmn1 A G 2: 113,365,796 I614V unknown Het
Fsd1l T A 4: 53,679,854 V184E probably damaging Het
Fyco1 A G 9: 123,797,662 V1328A probably damaging Het
Ganab T A 19: 8,911,652 N572K probably null Het
Gm13078 T G 4: 143,727,059 W246G probably benign Het
Gpr83 T G 9: 14,868,267 L205R probably damaging Het
Hapln2 G A 3: 88,023,629 P152S probably damaging Het
Htatip2 T C 7: 49,773,392 Y232H probably benign Het
Itga2b C T 11: 102,467,426 V158I probably damaging Het
Kansl3 T C 1: 36,351,783 D390G probably damaging Het
Kcnh2 T C 5: 24,351,237 D16G probably benign Het
Kctd8 A T 5: 69,341,010 F98I probably damaging Het
Kif21b A T 1: 136,149,311 E357V probably damaging Het
Kmt5c C T 7: 4,746,595 R371C probably damaging Het
Kndc1 T C 7: 139,910,304 F241L probably benign Het
Lrba A G 3: 86,540,005 D2052G probably damaging Het
Lsr T A 7: 30,959,273 I54F probably damaging Het
Matk G T 10: 81,258,494 L28F probably benign Het
Mdn1 T C 4: 32,750,318 L4429P probably damaging Het
Med29 CCTGCTGCTGCTGCTGC CCTGCTGCTGCTGC 7: 28,392,510 probably benign Het
Msln G T 17: 25,750,276 Q407K possibly damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Myof A G 19: 37,910,969 I1040T probably damaging Het
Nckap5 A G 1: 126,026,434 S794P probably benign Het
Nfkbiz C T 16: 55,818,991 probably null Het
Nr2c1 C T 10: 94,195,182 S535L probably damaging Het
Olfr1448 A T 19: 12,919,935 C125S probably damaging Het
Olfr665 A T 7: 104,880,992 D95V possibly damaging Het
Olfr747 G A 14: 50,681,254 R127C probably benign Het
Opn3 A C 1: 175,692,304 L78R probably damaging Het
Pcdhb9 A G 18: 37,402,579 N542S probably damaging Het
Pdc T A 1: 150,333,427 N220K probably benign Het
Pde6c A T 19: 38,162,349 N569Y probably damaging Het
Pgm2 A T 4: 99,963,617 K219M probably damaging Het
Pitpnb C T 5: 111,347,126 T99M possibly damaging Het
Pou6f2 T A 13: 18,152,004 Q71L probably damaging Het
Prkd1 C A 12: 50,366,356 L677F probably damaging Het
Ranbp17 T C 11: 33,500,689 I78V probably benign Het
Rnft2 T A 5: 118,201,385 K362M possibly damaging Het
Rprd1a T A 18: 24,506,847 E259V possibly damaging Het
Scara3 A T 14: 65,931,781 I129N probably damaging Het
Scgb1a1 A T 19: 9,085,389 probably null Het
Sec16b A T 1: 157,532,176 probably null Het
Slc18a1 A T 8: 69,072,101 M167K probably damaging Het
Slc6a15 C T 10: 103,418,225 A674V probably benign Het
Slc6a3 T C 13: 73,567,557 F437S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stag1 T A 9: 100,776,784 N141K probably damaging Het
Sun2 T C 15: 79,730,232 E321G probably damaging Het
Taar2 C A 10: 23,941,429 T289K possibly damaging Het
Taar2 T C 10: 23,941,509 Y316H probably benign Het
Tbcd T A 11: 121,602,983 probably null Het
Tecr G A 8: 83,572,275 T106I probably damaging Het
Tmem60 T G 5: 20,886,630 V131G probably benign Het
Uimc1 A G 13: 55,075,991 V156A probably benign Het
Usp28 G A 9: 49,010,281 W266* probably null Het
Vmn2r17 T A 5: 109,428,336 S358T probably damaging Het
Wwc2 T A 8: 47,868,666 Y471F unknown Het
Ythdc1 C T 5: 86,835,720 R675C probably damaging Het
Zfp30 T C 7: 29,793,604 S428P probably damaging Het
Zfp462 T A 4: 55,008,768 C245S probably benign Het
Zscan30 T C 18: 23,971,398 noncoding transcript Het
Other mutations in Gbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Gbp10 APN 5 105221114 splice site probably benign
IGL01680:Gbp10 APN 5 105224271 splice site probably null
IGL01809:Gbp10 APN 5 105217359 missense probably benign
IGL01845:Gbp10 APN 5 105219949 splice site probably null
IGL02011:Gbp10 APN 5 105221101 missense probably damaging 1.00
IGL02063:Gbp10 APN 5 105236040 missense possibly damaging 0.95
IGL02533:Gbp10 APN 5 105220035 missense probably damaging 1.00
IGL02612:Gbp10 APN 5 105218502 missense possibly damaging 0.88
R0462:Gbp10 UTSW 5 105218524 missense possibly damaging 0.67
R0535:Gbp10 UTSW 5 105221011 missense possibly damaging 0.95
R1223:Gbp10 UTSW 5 105219001 missense probably damaging 1.00
R1704:Gbp10 UTSW 5 105224351 missense probably damaging 1.00
R1792:Gbp10 UTSW 5 105224300 missense probably damaging 1.00
R3738:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R3739:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R4035:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R4421:Gbp10 UTSW 5 105224651 splice site probably null
R5207:Gbp10 UTSW 5 105224709 missense probably benign 0.05
R5338:Gbp10 UTSW 5 105224300 missense probably damaging 1.00
R6010:Gbp10 UTSW 5 105224339 missense probably damaging 1.00
R6045:Gbp10 UTSW 5 105218403 missense probably damaging 0.98
R6156:Gbp10 UTSW 5 105236149 start gained probably benign
R6285:Gbp10 UTSW 5 105218460 missense probably damaging 1.00
R6525:Gbp10 UTSW 5 105236084 missense probably benign 0.01
R6908:Gbp10 UTSW 5 105221032 missense probably damaging 0.97
R7339:Gbp10 UTSW 5 105220098 missense possibly damaging 0.77
R7396:Gbp10 UTSW 5 105236149 start gained probably benign
R7397:Gbp10 UTSW 5 105236149 start gained probably benign
R7399:Gbp10 UTSW 5 105236149 start gained probably benign
R7554:Gbp10 UTSW 5 105236149 start gained probably benign
R7555:Gbp10 UTSW 5 105236149 start gained probably benign
R7574:Gbp10 UTSW 5 105236149 start gained probably benign
R7575:Gbp10 UTSW 5 105236149 start gained probably benign
R7576:Gbp10 UTSW 5 105236149 start gained probably benign
R7577:Gbp10 UTSW 5 105236149 start gained probably benign
R7578:Gbp10 UTSW 5 105236149 start gained probably benign
R7975:Gbp10 UTSW 5 105221101 missense probably benign 0.20
R8293:Gbp10 UTSW 5 105224369 missense probably damaging 1.00
R8708:Gbp10 UTSW 5 105220965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAATGCTCCATGAAGACAGCC -3'
(R):5'- AACCACTAAAGCTGATCCCTTCTGC -3'

Sequencing Primer
(F):5'- ATGGCTTCCTTCTCGCAGG -3'
(R):5'- CTGAAGGAGGTTTtgtgtgtg -3'
Posted On2013-05-09