Mutagenetix > Incidental Mutation

Incidental Mutation 'R0349:Atp10a'

36078

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

MMRRC Submission

038556-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R0349 (G1)

Quality Score

115

Status

Not validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58803467 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 798 (D798G)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747]

AlphaFold

O54827

Predicted Effect

probably damaging
Transcript: ENSMUST00000168747
AA Change: D798G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: D798G

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
A1cf	A	T	19: 31,932,662	S285C	possibly damaging	Het
Abcc9	A	T	6: 142,664,625	N604K	probably benign	Het
Adgrl3	A	G	5: 81,771,644	T1192A	probably damaging	Het
Aldh1l2	A	T	10: 83,490,614	Y800N	probably damaging	Het
Ano3	A	T	2: 110,661,487	V865D	probably damaging	Het
App	A	T	16: 85,013,680	L545Q	probably damaging	Het
B3galnt2	T	C	13: 13,991,474	V318A	probably benign	Het
BC005561	T	C	5: 104,519,976	L788P	possibly damaging	Het
Clcn3	T	A	8: 60,941,348	D49V	possibly damaging	Het
Clcn6	T	A	4: 148,024,194	K126M	possibly damaging	Het
Cntln	T	A	4: 84,996,485	S510T	probably damaging	Het
Csk	A	C	9: 57,628,194	C290W	probably damaging	Het
Dmxl1	T	A	18: 49,879,282	M1502K	probably damaging	Het
Dpy19l2	T	A	9: 24,695,922	N81I	possibly damaging	Het
Dpyd	T	A	3: 118,917,099	C385*	probably null	Het
Dst	G	A	1: 34,199,553	V1765I	probably benign	Het
Eif5b	A	G	1: 38,032,366	S459G	probably benign	Het
Fam105a	T	A	15: 27,664,790	I27L	probably benign	Het
Fam83d	A	G	2: 158,779,848	I160V	possibly damaging	Het
Fat3	A	G	9: 16,031,180	F1299L	probably damaging	Het
Fmn1	A	G	2: 113,365,796	I614V	unknown	Het
Fsd1l	T	A	4: 53,679,854	V184E	probably damaging	Het
Fyco1	A	G	9: 123,797,662	V1328A	probably damaging	Het
Ganab	T	A	19: 8,911,652	N572K	probably null	Het
Gbp10	T	A	5: 105,221,076	D299V	possibly damaging	Het
Gm13078	T	G	4: 143,727,059	W246G	probably benign	Het
Gpr83	T	G	9: 14,868,267	L205R	probably damaging	Het
Hapln2	G	A	3: 88,023,629	P152S	probably damaging	Het
Htatip2	T	C	7: 49,773,392	Y232H	probably benign	Het
Itga2b	C	T	11: 102,467,426	V158I	probably damaging	Het
Kansl3	T	C	1: 36,351,783	D390G	probably damaging	Het
Kcnh2	T	C	5: 24,351,237	D16G	probably benign	Het
Kctd8	A	T	5: 69,341,010	F98I	probably damaging	Het
Kif21b	A	T	1: 136,149,311	E357V	probably damaging	Het
Kmt5c	C	T	7: 4,746,595	R371C	probably damaging	Het
Kndc1	T	C	7: 139,910,304	F241L	probably benign	Het
Lrba	A	G	3: 86,540,005	D2052G	probably damaging	Het
Lsr	T	A	7: 30,959,273	I54F	probably damaging	Het
Matk	G	T	10: 81,258,494	L28F	probably benign	Het
Mdn1	T	C	4: 32,750,318	L4429P	probably damaging	Het
Med29	CCTGCTGCTGCTGCTGC	CCTGCTGCTGCTGC	7: 28,392,510		probably benign	Het
Msln	G	T	17: 25,750,276	Q407K	possibly damaging	Het
Msr1	C	T	8: 39,581,827	G428R	probably damaging	Het
Myof	A	G	19: 37,910,969	I1040T	probably damaging	Het
Nckap5	A	G	1: 126,026,434	S794P	probably benign	Het
Nfkbiz	C	T	16: 55,818,991		probably null	Het
Nr2c1	C	T	10: 94,195,182	S535L	probably damaging	Het
Olfr1448	A	T	19: 12,919,935	C125S	probably damaging	Het
Olfr665	A	T	7: 104,880,992	D95V	possibly damaging	Het
Olfr747	G	A	14: 50,681,254	R127C	probably benign	Het
Opn3	A	C	1: 175,692,304	L78R	probably damaging	Het
Pcdhb9	A	G	18: 37,402,579	N542S	probably damaging	Het
Pdc	T	A	1: 150,333,427	N220K	probably benign	Het
Pde6c	A	T	19: 38,162,349	N569Y	probably damaging	Het
Pgm2	A	T	4: 99,963,617	K219M	probably damaging	Het
Pitpnb	C	T	5: 111,347,126	T99M	possibly damaging	Het
Pou6f2	T	A	13: 18,152,004	Q71L	probably damaging	Het
Prkd1	C	A	12: 50,366,356	L677F	probably damaging	Het
Ranbp17	T	C	11: 33,500,689	I78V	probably benign	Het
Rnft2	T	A	5: 118,201,385	K362M	possibly damaging	Het
Rprd1a	T	A	18: 24,506,847	E259V	possibly damaging	Het
Scara3	A	T	14: 65,931,781	I129N	probably damaging	Het
Scgb1a1	A	T	19: 9,085,389		probably null	Het
Sec16b	A	T	1: 157,532,176		probably null	Het
Slc18a1	A	T	8: 69,072,101	M167K	probably damaging	Het
Slc6a15	C	T	10: 103,418,225	A674V	probably benign	Het
Slc6a3	T	C	13: 73,567,557	F437S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Stag1	T	A	9: 100,776,784	N141K	probably damaging	Het
Sun2	T	C	15: 79,730,232	E321G	probably damaging	Het
Taar2	C	A	10: 23,941,429	T289K	possibly damaging	Het
Taar2	T	C	10: 23,941,509	Y316H	probably benign	Het
Tbcd	T	A	11: 121,602,983		probably null	Het
Tecr	G	A	8: 83,572,275	T106I	probably damaging	Het
Tmem60	T	G	5: 20,886,630	V131G	probably benign	Het
Uimc1	A	G	13: 55,075,991	V156A	probably benign	Het
Usp28	G	A	9: 49,010,281	W266*	probably null	Het
Vmn2r17	T	A	5: 109,428,336	S358T	probably damaging	Het
Wwc2	T	A	8: 47,868,666	Y471F	unknown	Het
Ythdc1	C	T	5: 86,835,720	R675C	probably damaging	Het
Zfp30	T	C	7: 29,793,604	S428P	probably damaging	Het
Zfp462	T	A	4: 55,008,768	C245S	probably benign	Het
Zscan30	T	C	18: 23,971,398		noncoding transcript	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	probably benign	0.00
R8166:Atp10a	UTSW	7	58807522	missense	possibly damaging	0.46
R8201:Atp10a	UTSW	7	58819676	nonsense	probably null
R8465:Atp10a	UTSW	7	58828310	missense	probably benign	0.32
R8858:Atp10a	UTSW	7	58816223	missense	probably damaging	1.00
R8985:Atp10a	UTSW	7	58788344	missense	probably benign	0.03
R9003:Atp10a	UTSW	7	58807455	missense	probably damaging	1.00
R9274:Atp10a	UTSW	7	58828621	missense	probably benign	0.22
R9385:Atp10a	UTSW	7	58828139	missense	probably benign	0.00
R9432:Atp10a	UTSW	7	58819670	missense	possibly damaging	0.95
R9454:Atp10a	UTSW	7	58658591	missense	probably benign
R9596:Atp10a	UTSW	7	58827805	missense	probably damaging	1.00
R9736:Atp10a	UTSW	7	58824330	missense	probably damaging	1.00
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCCGAGGGAGAAAATACAGTTCCAC -3'
(R):5'- TGGAGACACACTGTTGAATGCTGC -3'

Sequencing Primer
(F):5'- TCCACTTAAATTTCAAATTCAgtgtg -3'
(R):5'- CTGTTGAATGCTGCGCTGG -3'

Posted On

2013-05-09