Mutagenetix > Incidental Mutation

Incidental Mutation 'R0349:Aldh1l2'

36099

Institutional Source

Beutler Lab

Gene Symbol

Aldh1l2

Ensembl Gene

ENSMUSG00000020256

Gene Name

aldehyde dehydrogenase 1 family, member L2

Synonyms

MMRRC Submission

038556-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0349 (G1)

Quality Score

145

Status

Not validated

Chromosome

Chromosomal Location

83487450-83534140 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 83490614 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 800 (Y800N)

Ref Sequence

ENSEMBL: ENSMUSP00000117076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020488] [ENSMUST00000020497] [ENSMUST00000146640]

AlphaFold

Q8K009

Predicted Effect

probably benign
Transcript: ENSMUST00000020488

SMART Domains

Protein: ENSMUSP00000020488
Gene: ENSMUSG00000020255

Domain	Start	End	E-Value	Type
Pfam:DUF4598	68	175	1.9e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000020497
AA Change: Y913N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: Y913N

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	23	202	5e-46	PFAM
Pfam:Formyl_trans_C	226	330	1.3e-16	PFAM
Pfam:PP-binding	346	412	9.6e-7	PFAM
Pfam:Aldedh	451	919	3.4e-174	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141184

Predicted Effect

probably damaging
Transcript: ENSMUST00000146640
AA Change: Y800N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: Y800N

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	1	89	2.8e-30	PFAM
Pfam:Formyl_trans_C	113	217	1.1e-16	PFAM
Pfam:PP-binding	233	299	1.5e-8	PFAM
Pfam:Aldedh	338	806	8.5e-175	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147381

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
A1cf	A	T	19: 31,932,662	S285C	possibly damaging	Het
Abcc9	A	T	6: 142,664,625	N604K	probably benign	Het
Adgrl3	A	G	5: 81,771,644	T1192A	probably damaging	Het
Ano3	A	T	2: 110,661,487	V865D	probably damaging	Het
App	A	T	16: 85,013,680	L545Q	probably damaging	Het
Atp10a	A	G	7: 58,803,467	D798G	probably damaging	Het
B3galnt2	T	C	13: 13,991,474	V318A	probably benign	Het
BC005561	T	C	5: 104,519,976	L788P	possibly damaging	Het
Clcn3	T	A	8: 60,941,348	D49V	possibly damaging	Het
Clcn6	T	A	4: 148,024,194	K126M	possibly damaging	Het
Cntln	T	A	4: 84,996,485	S510T	probably damaging	Het
Csk	A	C	9: 57,628,194	C290W	probably damaging	Het
Dmxl1	T	A	18: 49,879,282	M1502K	probably damaging	Het
Dpy19l2	T	A	9: 24,695,922	N81I	possibly damaging	Het
Dpyd	T	A	3: 118,917,099	C385*	probably null	Het
Dst	G	A	1: 34,199,553	V1765I	probably benign	Het
Eif5b	A	G	1: 38,032,366	S459G	probably benign	Het
Fam105a	T	A	15: 27,664,790	I27L	probably benign	Het
Fam83d	A	G	2: 158,779,848	I160V	possibly damaging	Het
Fat3	A	G	9: 16,031,180	F1299L	probably damaging	Het
Fmn1	A	G	2: 113,365,796	I614V	unknown	Het
Fsd1l	T	A	4: 53,679,854	V184E	probably damaging	Het
Fyco1	A	G	9: 123,797,662	V1328A	probably damaging	Het
Ganab	T	A	19: 8,911,652	N572K	probably null	Het
Gbp10	T	A	5: 105,221,076	D299V	possibly damaging	Het
Gm13078	T	G	4: 143,727,059	W246G	probably benign	Het
Gpr83	T	G	9: 14,868,267	L205R	probably damaging	Het
Hapln2	G	A	3: 88,023,629	P152S	probably damaging	Het
Htatip2	T	C	7: 49,773,392	Y232H	probably benign	Het
Itga2b	C	T	11: 102,467,426	V158I	probably damaging	Het
Kansl3	T	C	1: 36,351,783	D390G	probably damaging	Het
Kcnh2	T	C	5: 24,351,237	D16G	probably benign	Het
Kctd8	A	T	5: 69,341,010	F98I	probably damaging	Het
Kif21b	A	T	1: 136,149,311	E357V	probably damaging	Het
Kmt5c	C	T	7: 4,746,595	R371C	probably damaging	Het
Kndc1	T	C	7: 139,910,304	F241L	probably benign	Het
Lrba	A	G	3: 86,540,005	D2052G	probably damaging	Het
Lsr	T	A	7: 30,959,273	I54F	probably damaging	Het
Matk	G	T	10: 81,258,494	L28F	probably benign	Het
Mdn1	T	C	4: 32,750,318	L4429P	probably damaging	Het
Med29	CCTGCTGCTGCTGCTGC	CCTGCTGCTGCTGC	7: 28,392,510		probably benign	Het
Msln	G	T	17: 25,750,276	Q407K	possibly damaging	Het
Msr1	C	T	8: 39,581,827	G428R	probably damaging	Het
Myof	A	G	19: 37,910,969	I1040T	probably damaging	Het
Nckap5	A	G	1: 126,026,434	S794P	probably benign	Het
Nfkbiz	C	T	16: 55,818,991		probably null	Het
Nr2c1	C	T	10: 94,195,182	S535L	probably damaging	Het
Olfr1448	A	T	19: 12,919,935	C125S	probably damaging	Het
Olfr665	A	T	7: 104,880,992	D95V	possibly damaging	Het
Olfr747	G	A	14: 50,681,254	R127C	probably benign	Het
Opn3	A	C	1: 175,692,304	L78R	probably damaging	Het
Pcdhb9	A	G	18: 37,402,579	N542S	probably damaging	Het
Pdc	T	A	1: 150,333,427	N220K	probably benign	Het
Pde6c	A	T	19: 38,162,349	N569Y	probably damaging	Het
Pgm2	A	T	4: 99,963,617	K219M	probably damaging	Het
Pitpnb	C	T	5: 111,347,126	T99M	possibly damaging	Het
Pou6f2	T	A	13: 18,152,004	Q71L	probably damaging	Het
Prkd1	C	A	12: 50,366,356	L677F	probably damaging	Het
Ranbp17	T	C	11: 33,500,689	I78V	probably benign	Het
Rnft2	T	A	5: 118,201,385	K362M	possibly damaging	Het
Rprd1a	T	A	18: 24,506,847	E259V	possibly damaging	Het
Scara3	A	T	14: 65,931,781	I129N	probably damaging	Het
Scgb1a1	A	T	19: 9,085,389		probably null	Het
Sec16b	A	T	1: 157,532,176		probably null	Het
Slc18a1	A	T	8: 69,072,101	M167K	probably damaging	Het
Slc6a15	C	T	10: 103,418,225	A674V	probably benign	Het
Slc6a3	T	C	13: 73,567,557	F437S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Stag1	T	A	9: 100,776,784	N141K	probably damaging	Het
Sun2	T	C	15: 79,730,232	E321G	probably damaging	Het
Taar2	C	A	10: 23,941,429	T289K	possibly damaging	Het
Taar2	T	C	10: 23,941,509	Y316H	probably benign	Het
Tbcd	T	A	11: 121,602,983		probably null	Het
Tecr	G	A	8: 83,572,275	T106I	probably damaging	Het
Tmem60	T	G	5: 20,886,630	V131G	probably benign	Het
Uimc1	A	G	13: 55,075,991	V156A	probably benign	Het
Usp28	G	A	9: 49,010,281	W266*	probably null	Het
Vmn2r17	T	A	5: 109,428,336	S358T	probably damaging	Het
Wwc2	T	A	8: 47,868,666	Y471F	unknown	Het
Ythdc1	C	T	5: 86,835,720	R675C	probably damaging	Het
Zfp30	T	C	7: 29,793,604	S428P	probably damaging	Het
Zfp462	T	A	4: 55,008,768	C245S	probably benign	Het
Zscan30	T	C	18: 23,971,398		noncoding transcript	Het

Other mutations in Aldh1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Aldh1l2	APN	10	83522886	nonsense	probably null
IGL01154:Aldh1l2	APN	10	83520373	missense	probably damaging	1.00
IGL01301:Aldh1l2	APN	10	83522846	missense	probably damaging	1.00
IGL01354:Aldh1l2	APN	10	83527376	missense	probably damaging	1.00
IGL01364:Aldh1l2	APN	10	83492667	missense	probably damaging	1.00
IGL01445:Aldh1l2	APN	10	83520262	splice site	probably benign
IGL02179:Aldh1l2	APN	10	83522837	missense	probably benign	0.10
IGL02283:Aldh1l2	APN	10	83495895	missense	probably benign	0.00
IGL02507:Aldh1l2	APN	10	83492584	nonsense	probably null
IGL02727:Aldh1l2	APN	10	83506605	missense	probably damaging	1.00
IGL03353:Aldh1l2	APN	10	83522913	missense	probably benign	0.17
Hunger_winter	UTSW	10	83508013	critical splice donor site	probably null
Spartan	UTSW	10	83512306	missense	possibly damaging	0.93
ANU18:Aldh1l2	UTSW	10	83522846	missense	probably damaging	1.00
IGL02984:Aldh1l2	UTSW	10	83527335	missense	probably damaging	1.00
R0267:Aldh1l2	UTSW	10	83522687	splice site	probably benign
R0302:Aldh1l2	UTSW	10	83520365	missense	probably damaging	1.00
R0468:Aldh1l2	UTSW	10	83518678	missense	probably benign	0.01
R0745:Aldh1l2	UTSW	10	83518630	splice site	probably null
R0788:Aldh1l2	UTSW	10	83516164	missense	probably damaging	1.00
R1117:Aldh1l2	UTSW	10	83508623	missense	probably benign	0.01
R1241:Aldh1l2	UTSW	10	83496025	missense	probably benign	0.00
R1420:Aldh1l2	UTSW	10	83495935	missense	probably damaging	1.00
R1490:Aldh1l2	UTSW	10	83520370	missense	probably damaging	1.00
R1704:Aldh1l2	UTSW	10	83508660	missense	probably benign	0.10
R1729:Aldh1l2	UTSW	10	83508082	nonsense	probably null
R1893:Aldh1l2	UTSW	10	83492536	missense	probably damaging	1.00
R1897:Aldh1l2	UTSW	10	83502525	missense	probably damaging	1.00
R2047:Aldh1l2	UTSW	10	83506743	missense	probably damaging	1.00
R2290:Aldh1l2	UTSW	10	83527313	missense	probably damaging	1.00
R3054:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R3055:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R4097:Aldh1l2	UTSW	10	83512364	missense	probably damaging	0.98
R4162:Aldh1l2	UTSW	10	83506654	missense	possibly damaging	0.50
R4295:Aldh1l2	UTSW	10	83495920	missense	possibly damaging	0.62
R4296:Aldh1l2	UTSW	10	83522777	missense	probably benign	0.34
R4388:Aldh1l2	UTSW	10	83513622	missense	probably damaging	1.00
R4809:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R5052:Aldh1l2	UTSW	10	83508692	missense	possibly damaging	0.92
R5421:Aldh1l2	UTSW	10	83527407	missense	probably damaging	1.00
R5491:Aldh1l2	UTSW	10	83522785	missense	probably benign	0.00
R5688:Aldh1l2	UTSW	10	83501925	missense	possibly damaging	0.93
R5726:Aldh1l2	UTSW	10	83512306	missense	possibly damaging	0.93
R5737:Aldh1l2	UTSW	10	83520325	missense	probably damaging	1.00
R5752:Aldh1l2	UTSW	10	83520380	missense	probably damaging	1.00
R6113:Aldh1l2	UTSW	10	83508134	nonsense	probably null
R6161:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R6166:Aldh1l2	UTSW	10	83493424	splice site	probably null
R6189:Aldh1l2	UTSW	10	83508013	critical splice donor site	probably null
R7357:Aldh1l2	UTSW	10	83514544	missense	possibly damaging	0.89
R7394:Aldh1l2	UTSW	10	83502457	missense	probably damaging	1.00
R7469:Aldh1l2	UTSW	10	83508105	missense	probably damaging	1.00
R7676:Aldh1l2	UTSW	10	83508111	missense	probably benign
R7848:Aldh1l2	UTSW	10	83499843	missense	probably benign	0.12
R7958:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R8311:Aldh1l2	UTSW	10	83490615	missense	probably damaging	1.00
R8477:Aldh1l2	UTSW	10	83501921	missense	probably damaging	1.00
R8730:Aldh1l2	UTSW	10	83506642	missense	possibly damaging	0.94
R8884:Aldh1l2	UTSW	10	83508677	missense	probably benign	0.02
R9117:Aldh1l2	UTSW	10	83506681	missense	probably benign	0.41
R9239:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R9335:Aldh1l2	UTSW	10	83506646	missense	probably damaging	0.96
R9368:Aldh1l2	UTSW	10	83495952	nonsense	probably null
R9784:Aldh1l2	UTSW	10	83506750	critical splice acceptor site	probably null
Z1177:Aldh1l2	UTSW	10	83493480	missense	probably damaging	1.00
Z1177:Aldh1l2	UTSW	10	83534005	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGCCCTCAGTCAGGTAAATGCTC -3'
(R):5'- TGGCACTGAAGCTTGTCATCCAAC -3'

Sequencing Primer
(F):5'- TGCTCATACAAGTGGTCTAACC -3'
(R):5'- GGTAGACTATCTAAGCCCTTACTG -3'

Posted On

2013-05-09