Mutagenetix > Incidental Mutation

Incidental Mutation 'R0349:Slc6a15'

36101

Institutional Source

Beutler Lab

Gene Symbol

Slc6a15

Ensembl Gene

ENSMUSG00000019894

Gene Name

solute carrier family 6 (neurotransmitter transporter), member 15

Synonyms

v7-3

MMRRC Submission

038556-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0349 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103367783-103419377 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 103418225 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 674 (A674V)

Ref Sequence

ENSEMBL: ENSMUSP00000136676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]

AlphaFold

Q8BG16

Predicted Effect

probably benign
Transcript: ENSMUST00000074204
AA Change: A674V

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: A674V

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179636
AA Change: A674V

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: A674V

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:SNF	61	644	2.2e-229	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
A1cf	A	T	19: 31,932,662	S285C	possibly damaging	Het
Abcc9	A	T	6: 142,664,625	N604K	probably benign	Het
Adgrl3	A	G	5: 81,771,644	T1192A	probably damaging	Het
Aldh1l2	A	T	10: 83,490,614	Y800N	probably damaging	Het
Ano3	A	T	2: 110,661,487	V865D	probably damaging	Het
App	A	T	16: 85,013,680	L545Q	probably damaging	Het
Atp10a	A	G	7: 58,803,467	D798G	probably damaging	Het
B3galnt2	T	C	13: 13,991,474	V318A	probably benign	Het
BC005561	T	C	5: 104,519,976	L788P	possibly damaging	Het
Clcn3	T	A	8: 60,941,348	D49V	possibly damaging	Het
Clcn6	T	A	4: 148,024,194	K126M	possibly damaging	Het
Cntln	T	A	4: 84,996,485	S510T	probably damaging	Het
Csk	A	C	9: 57,628,194	C290W	probably damaging	Het
Dmxl1	T	A	18: 49,879,282	M1502K	probably damaging	Het
Dpy19l2	T	A	9: 24,695,922	N81I	possibly damaging	Het
Dpyd	T	A	3: 118,917,099	C385*	probably null	Het
Dst	G	A	1: 34,199,553	V1765I	probably benign	Het
Eif5b	A	G	1: 38,032,366	S459G	probably benign	Het
Fam105a	T	A	15: 27,664,790	I27L	probably benign	Het
Fam83d	A	G	2: 158,779,848	I160V	possibly damaging	Het
Fat3	A	G	9: 16,031,180	F1299L	probably damaging	Het
Fmn1	A	G	2: 113,365,796	I614V	unknown	Het
Fsd1l	T	A	4: 53,679,854	V184E	probably damaging	Het
Fyco1	A	G	9: 123,797,662	V1328A	probably damaging	Het
Ganab	T	A	19: 8,911,652	N572K	probably null	Het
Gbp10	T	A	5: 105,221,076	D299V	possibly damaging	Het
Gm13078	T	G	4: 143,727,059	W246G	probably benign	Het
Gpr83	T	G	9: 14,868,267	L205R	probably damaging	Het
Hapln2	G	A	3: 88,023,629	P152S	probably damaging	Het
Htatip2	T	C	7: 49,773,392	Y232H	probably benign	Het
Itga2b	C	T	11: 102,467,426	V158I	probably damaging	Het
Kansl3	T	C	1: 36,351,783	D390G	probably damaging	Het
Kcnh2	T	C	5: 24,351,237	D16G	probably benign	Het
Kctd8	A	T	5: 69,341,010	F98I	probably damaging	Het
Kif21b	A	T	1: 136,149,311	E357V	probably damaging	Het
Kmt5c	C	T	7: 4,746,595	R371C	probably damaging	Het
Kndc1	T	C	7: 139,910,304	F241L	probably benign	Het
Lrba	A	G	3: 86,540,005	D2052G	probably damaging	Het
Lsr	T	A	7: 30,959,273	I54F	probably damaging	Het
Matk	G	T	10: 81,258,494	L28F	probably benign	Het
Mdn1	T	C	4: 32,750,318	L4429P	probably damaging	Het
Med29	CCTGCTGCTGCTGCTGC	CCTGCTGCTGCTGC	7: 28,392,510		probably benign	Het
Msln	G	T	17: 25,750,276	Q407K	possibly damaging	Het
Msr1	C	T	8: 39,581,827	G428R	probably damaging	Het
Myof	A	G	19: 37,910,969	I1040T	probably damaging	Het
Nckap5	A	G	1: 126,026,434	S794P	probably benign	Het
Nfkbiz	C	T	16: 55,818,991		probably null	Het
Nr2c1	C	T	10: 94,195,182	S535L	probably damaging	Het
Olfr1448	A	T	19: 12,919,935	C125S	probably damaging	Het
Olfr665	A	T	7: 104,880,992	D95V	possibly damaging	Het
Olfr747	G	A	14: 50,681,254	R127C	probably benign	Het
Opn3	A	C	1: 175,692,304	L78R	probably damaging	Het
Pcdhb9	A	G	18: 37,402,579	N542S	probably damaging	Het
Pdc	T	A	1: 150,333,427	N220K	probably benign	Het
Pde6c	A	T	19: 38,162,349	N569Y	probably damaging	Het
Pgm2	A	T	4: 99,963,617	K219M	probably damaging	Het
Pitpnb	C	T	5: 111,347,126	T99M	possibly damaging	Het
Pou6f2	T	A	13: 18,152,004	Q71L	probably damaging	Het
Prkd1	C	A	12: 50,366,356	L677F	probably damaging	Het
Ranbp17	T	C	11: 33,500,689	I78V	probably benign	Het
Rnft2	T	A	5: 118,201,385	K362M	possibly damaging	Het
Rprd1a	T	A	18: 24,506,847	E259V	possibly damaging	Het
Scara3	A	T	14: 65,931,781	I129N	probably damaging	Het
Scgb1a1	A	T	19: 9,085,389		probably null	Het
Sec16b	A	T	1: 157,532,176		probably null	Het
Slc18a1	A	T	8: 69,072,101	M167K	probably damaging	Het
Slc6a3	T	C	13: 73,567,557	F437S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Stag1	T	A	9: 100,776,784	N141K	probably damaging	Het
Sun2	T	C	15: 79,730,232	E321G	probably damaging	Het
Taar2	C	A	10: 23,941,429	T289K	possibly damaging	Het
Taar2	T	C	10: 23,941,509	Y316H	probably benign	Het
Tbcd	T	A	11: 121,602,983		probably null	Het
Tecr	G	A	8: 83,572,275	T106I	probably damaging	Het
Tmem60	T	G	5: 20,886,630	V131G	probably benign	Het
Uimc1	A	G	13: 55,075,991	V156A	probably benign	Het
Usp28	G	A	9: 49,010,281	W266*	probably null	Het
Vmn2r17	T	A	5: 109,428,336	S358T	probably damaging	Het
Wwc2	T	A	8: 47,868,666	Y471F	unknown	Het
Ythdc1	C	T	5: 86,835,720	R675C	probably damaging	Het
Zfp30	T	C	7: 29,793,604	S428P	probably damaging	Het
Zfp462	T	A	4: 55,008,768	C245S	probably benign	Het
Zscan30	T	C	18: 23,971,398		noncoding transcript	Het

Other mutations in Slc6a15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Slc6a15	APN	10	103389141	missense	probably benign
IGL01320:Slc6a15	APN	10	103404745	missense	probably benign	0.00
IGL01924:Slc6a15	APN	10	103404825	splice site	probably null
IGL02066:Slc6a15	APN	10	103416658	missense	probably damaging	0.98
IGL02164:Slc6a15	APN	10	103418222	missense	probably benign	0.01
IGL02551:Slc6a15	APN	10	103404275	splice site	probably benign
IGL02744:Slc6a15	APN	10	103418033	missense	probably benign	0.03
R0028:Slc6a15	UTSW	10	103416680	missense	probably benign	0.00
R0143:Slc6a15	UTSW	10	103418068	missense	probably benign	0.02
R0158:Slc6a15	UTSW	10	103389347	splice site	probably benign
R0165:Slc6a15	UTSW	10	103409809	missense	probably null	0.04
R0383:Slc6a15	UTSW	10	103418053	missense	probably damaging	1.00
R0614:Slc6a15	UTSW	10	103404352	nonsense	probably null
R0784:Slc6a15	UTSW	10	103416800	splice site	probably benign
R0944:Slc6a15	UTSW	10	103409796	missense	probably benign	0.01
R1795:Slc6a15	UTSW	10	103400260	missense	probably benign
R1882:Slc6a15	UTSW	10	103395064	missense	probably benign	0.20
R2061:Slc6a15	UTSW	10	103409734	missense	probably benign	0.20
R2156:Slc6a15	UTSW	10	103393408	missense	probably damaging	1.00
R2358:Slc6a15	UTSW	10	103416785	missense	probably benign	0.00
R2849:Slc6a15	UTSW	10	103404691	missense	probably benign	0.01
R2921:Slc6a15	UTSW	10	103418387	missense	probably damaging	0.99
R3709:Slc6a15	UTSW	10	103393414	missense	probably benign	0.00
R4532:Slc6a15	UTSW	10	103409787	missense	possibly damaging	0.69
R4825:Slc6a15	UTSW	10	103418060	missense	probably benign	0.05
R4909:Slc6a15	UTSW	10	103404414	missense	probably damaging	1.00
R5112:Slc6a15	UTSW	10	103389226	missense	probably benign
R5320:Slc6a15	UTSW	10	103408206	missense	probably damaging	1.00
R5364:Slc6a15	UTSW	10	103393508	missense	probably damaging	0.99
R6305:Slc6a15	UTSW	10	103389170	missense	probably benign	0.31
R6348:Slc6a15	UTSW	10	103404367	missense	probably damaging	1.00
R6729:Slc6a15	UTSW	10	103393914	missense	probably damaging	0.99
R6781:Slc6a15	UTSW	10	103395067	missense	probably damaging	0.99
R7409:Slc6a15	UTSW	10	103408302	missense	probably benign
R7549:Slc6a15	UTSW	10	103389137	missense	probably benign
R7660:Slc6a15	UTSW	10	103393380	splice site	probably null
R7839:Slc6a15	UTSW	10	103404799	missense	probably benign
R7948:Slc6a15	UTSW	10	103404295	missense	possibly damaging	0.95
R8278:Slc6a15	UTSW	10	103394029	critical splice donor site	probably null
R8379:Slc6a15	UTSW	10	103389187	missense	probably benign	0.00
R8685:Slc6a15	UTSW	10	103409695	missense	possibly damaging	0.68
R8712:Slc6a15	UTSW	10	103389251	missense	probably damaging	1.00
R8719:Slc6a15	UTSW	10	103404315	missense	probably damaging	0.99
R8832:Slc6a15	UTSW	10	103389318	missense	probably damaging	1.00
R8940:Slc6a15	UTSW	10	103393496	missense	probably damaging	1.00
R8978:Slc6a15	UTSW	10	103395092	nonsense	probably null
R9050:Slc6a15	UTSW	10	103416655	missense	possibly damaging	0.88
R9113:Slc6a15	UTSW	10	103400279	missense	probably damaging	1.00
R9242:Slc6a15	UTSW	10	103393545	nonsense	probably null
R9493:Slc6a15	UTSW	10	103393416	missense	probably benign	0.35
R9529:Slc6a15	UTSW	10	103404722	missense	probably benign	0.14
R9532:Slc6a15	UTSW	10	103404472	missense	probably damaging	0.98
RF013:Slc6a15	UTSW	10	103400216	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGGCATCGGAAGAATTTCTGAGC -3'
(R):5'- GATCACCGTGTGATAGTGAAGCCC -3'

Sequencing Primer
(F):5'- TCGGAAGAATTTCTGAGCTACCC -3'
(R):5'- GATAGTGAAGCCCAATGCTTCTC -3'

Posted On

2013-05-09