Incidental Mutation 'R0349:Prkd1'
ID 36106
Institutional Source Beutler Lab
Gene Symbol Prkd1
Ensembl Gene ENSMUSG00000002688
Gene Name protein kinase D1
Synonyms PKD1, Prkcm, Pkcm
MMRRC Submission 038556-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0349 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 50388014-50695881 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 50413139 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 677 (L677F)
Ref Sequence ENSEMBL: ENSMUSP00000002765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002765]
AlphaFold Q62101
Predicted Effect probably damaging
Transcript: ENSMUST00000002765
AA Change: L677F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002765
Gene: ENSMUSG00000002688
AA Change: L677F

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
C1 138 194 1.36e-12 SMART
C1 277 326 5.95e-18 SMART
PH 429 549 5.33e-9 SMART
S_TKc 589 845 1.24e-92 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase involved in many cellular processes, including Golgi body membrane integrity and transport, cell migration and differentiation, MAPK8/JNK1 and Ras pathway signaling, MAPK1/3 (ERK1/2) pathway signaling, cell survival, and regulation of cell shape and adhesion. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality. Mice homozygous for a knock-in allele display partial embryonic and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,910,062 (GRCm39) S285C possibly damaging Het
Abcc9 A T 6: 142,610,351 (GRCm39) N604K probably benign Het
Acsbg3 T A 17: 57,192,169 (GRCm39) Y577* probably null Het
Adgrl3 A G 5: 81,919,491 (GRCm39) T1192A probably damaging Het
Aldh1l2 A T 10: 83,326,478 (GRCm39) Y800N probably damaging Het
Ano3 A T 2: 110,491,832 (GRCm39) V865D probably damaging Het
App A T 16: 84,810,568 (GRCm39) L545Q probably damaging Het
Atp10a A G 7: 58,453,215 (GRCm39) D798G probably damaging Het
B3galnt2 T C 13: 14,166,059 (GRCm39) V318A probably benign Het
Clcn3 T A 8: 61,394,382 (GRCm39) D49V possibly damaging Het
Clcn6 T A 4: 148,108,651 (GRCm39) K126M possibly damaging Het
Cntln T A 4: 84,914,722 (GRCm39) S510T probably damaging Het
Csk A C 9: 57,535,477 (GRCm39) C290W probably damaging Het
Dmxl1 T A 18: 50,012,349 (GRCm39) M1502K probably damaging Het
Dpy19l2 T A 9: 24,607,218 (GRCm39) N81I possibly damaging Het
Dpyd T A 3: 118,710,748 (GRCm39) C385* probably null Het
Dst G A 1: 34,238,634 (GRCm39) V1765I probably benign Het
Eif5b A G 1: 38,071,447 (GRCm39) S459G probably benign Het
Fam83d A G 2: 158,621,768 (GRCm39) I160V possibly damaging Het
Fat3 A G 9: 15,942,476 (GRCm39) F1299L probably damaging Het
Fmn1 A G 2: 113,196,141 (GRCm39) I614V unknown Het
Fsd1l T A 4: 53,679,854 (GRCm39) V184E probably damaging Het
Fyco1 A G 9: 123,626,727 (GRCm39) V1328A probably damaging Het
Ganab T A 19: 8,889,016 (GRCm39) N572K probably null Het
Gbp10 T A 5: 105,368,942 (GRCm39) D299V possibly damaging Het
Gpr83 T G 9: 14,779,563 (GRCm39) L205R probably damaging Het
Hapln2 G A 3: 87,930,936 (GRCm39) P152S probably damaging Het
Htatip2 T C 7: 49,423,140 (GRCm39) Y232H probably benign Het
Itga2b C T 11: 102,358,252 (GRCm39) V158I probably damaging Het
Kansl3 T C 1: 36,390,864 (GRCm39) D390G probably damaging Het
Kcnh2 T C 5: 24,556,235 (GRCm39) D16G probably benign Het
Kctd8 A T 5: 69,498,353 (GRCm39) F98I probably damaging Het
Kif21b A T 1: 136,077,049 (GRCm39) E357V probably damaging Het
Kmt5c C T 7: 4,749,594 (GRCm39) R371C probably damaging Het
Kndc1 T C 7: 139,490,220 (GRCm39) F241L probably benign Het
Lrba A G 3: 86,447,312 (GRCm39) D2052G probably damaging Het
Lsr T A 7: 30,658,698 (GRCm39) I54F probably damaging Het
Matk G T 10: 81,094,328 (GRCm39) L28F probably benign Het
Mdn1 T C 4: 32,750,318 (GRCm39) L4429P probably damaging Het
Med29 CCTGCTGCTGCTGCTGC CCTGCTGCTGCTGC 7: 28,091,935 (GRCm39) probably benign Het
Msln G T 17: 25,969,250 (GRCm39) Q407K possibly damaging Het
Msr1 C T 8: 40,034,868 (GRCm39) G428R probably damaging Het
Myof A G 19: 37,899,417 (GRCm39) I1040T probably damaging Het
Nckap5 A G 1: 125,954,171 (GRCm39) S794P probably benign Het
Nfkbiz C T 16: 55,639,354 (GRCm39) probably null Het
Nr2c1 C T 10: 94,031,044 (GRCm39) S535L probably damaging Het
Opn3 A C 1: 175,519,870 (GRCm39) L78R probably damaging Het
Or11h4b G A 14: 50,918,711 (GRCm39) R127C probably benign Het
Or52n3 A T 7: 104,530,199 (GRCm39) D95V possibly damaging Het
Or5b12 A T 19: 12,897,299 (GRCm39) C125S probably damaging Het
Otulinl T A 15: 27,664,876 (GRCm39) I27L probably benign Het
Pcdhb9 A G 18: 37,535,632 (GRCm39) N542S probably damaging Het
Pdc T A 1: 150,209,178 (GRCm39) N220K probably benign Het
Pde6c A T 19: 38,150,797 (GRCm39) N569Y probably damaging Het
Pgm1 A T 4: 99,820,814 (GRCm39) K219M probably damaging Het
Pitpnb C T 5: 111,494,992 (GRCm39) T99M possibly damaging Het
Pou6f2 T A 13: 18,326,589 (GRCm39) Q71L probably damaging Het
Pramel24 T G 4: 143,453,629 (GRCm39) W246G probably benign Het
Ranbp17 T C 11: 33,450,689 (GRCm39) I78V probably benign Het
Rnft2 T A 5: 118,339,450 (GRCm39) K362M possibly damaging Het
Rprd1a T A 18: 24,639,904 (GRCm39) E259V possibly damaging Het
Scara3 A T 14: 66,169,230 (GRCm39) I129N probably damaging Het
Scgb1a1 A T 19: 9,062,753 (GRCm39) probably null Het
Sec16b A T 1: 157,359,746 (GRCm39) probably null Het
Slc18a1 A T 8: 69,524,753 (GRCm39) M167K probably damaging Het
Slc6a15 C T 10: 103,254,086 (GRCm39) A674V probably benign Het
Slc6a3 T C 13: 73,715,676 (GRCm39) F437S probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Stag1 T A 9: 100,658,837 (GRCm39) N141K probably damaging Het
Sun2 T C 15: 79,614,433 (GRCm39) E321G probably damaging Het
Taar2 C A 10: 23,817,327 (GRCm39) T289K possibly damaging Het
Taar2 T C 10: 23,817,407 (GRCm39) Y316H probably benign Het
Tbcd T A 11: 121,493,809 (GRCm39) probably null Het
Tecr G A 8: 84,298,904 (GRCm39) T106I probably damaging Het
Thoc2l T C 5: 104,667,842 (GRCm39) L788P possibly damaging Het
Tmem60 T G 5: 21,091,628 (GRCm39) V131G probably benign Het
Uimc1 A G 13: 55,223,804 (GRCm39) V156A probably benign Het
Usp28 G A 9: 48,921,581 (GRCm39) W266* probably null Het
Vmn2r17 T A 5: 109,576,202 (GRCm39) S358T probably damaging Het
Wwc2 T A 8: 48,321,701 (GRCm39) Y471F unknown Het
Ythdc1 C T 5: 86,983,579 (GRCm39) R675C probably damaging Het
Zfp30 T C 7: 29,493,029 (GRCm39) S428P probably damaging Het
Zfp462 T A 4: 55,008,768 (GRCm39) C245S probably benign Het
Zscan30 T C 18: 24,104,455 (GRCm39) noncoding transcript Het
Other mutations in Prkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prkd1 APN 12 50,430,264 (GRCm39) missense probably damaging 1.00
IGL00727:Prkd1 APN 12 50,411,444 (GRCm39) missense probably damaging 1.00
IGL00772:Prkd1 APN 12 50,430,199 (GRCm39) missense probably damaging 0.99
IGL01092:Prkd1 APN 12 50,430,298 (GRCm39) splice site probably benign
IGL01457:Prkd1 APN 12 50,439,693 (GRCm39) nonsense probably null
IGL01538:Prkd1 APN 12 50,388,925 (GRCm39) missense probably benign
IGL01762:Prkd1 APN 12 50,434,013 (GRCm39) missense probably benign 0.00
IGL01876:Prkd1 APN 12 50,413,131 (GRCm39) missense probably damaging 1.00
IGL01973:Prkd1 APN 12 50,413,162 (GRCm39) missense probably damaging 1.00
IGL02086:Prkd1 APN 12 50,434,046 (GRCm39) missense probably benign
IGL02293:Prkd1 APN 12 50,536,761 (GRCm39) missense probably damaging 0.97
IGL02454:Prkd1 APN 12 50,411,456 (GRCm39) missense probably benign 0.09
IGL03309:Prkd1 APN 12 50,435,207 (GRCm39) missense probably damaging 1.00
R0457:Prkd1 UTSW 12 50,413,155 (GRCm39) missense probably damaging 0.99
R0627:Prkd1 UTSW 12 50,536,824 (GRCm39) missense probably benign 0.00
R0899:Prkd1 UTSW 12 50,431,976 (GRCm39) missense probably damaging 0.98
R1219:Prkd1 UTSW 12 50,435,125 (GRCm39) missense probably damaging 1.00
R1495:Prkd1 UTSW 12 50,413,135 (GRCm39) missense probably damaging 1.00
R1584:Prkd1 UTSW 12 50,472,298 (GRCm39) missense probably damaging 1.00
R1665:Prkd1 UTSW 12 50,441,709 (GRCm39) missense probably damaging 1.00
R1666:Prkd1 UTSW 12 50,441,709 (GRCm39) missense probably damaging 1.00
R1668:Prkd1 UTSW 12 50,441,709 (GRCm39) missense probably damaging 1.00
R1669:Prkd1 UTSW 12 50,441,709 (GRCm39) missense probably damaging 1.00
R1735:Prkd1 UTSW 12 50,388,822 (GRCm39) missense possibly damaging 0.79
R1939:Prkd1 UTSW 12 50,441,777 (GRCm39) missense probably benign 0.00
R2143:Prkd1 UTSW 12 50,536,694 (GRCm39) missense possibly damaging 0.77
R2145:Prkd1 UTSW 12 50,536,694 (GRCm39) missense possibly damaging 0.77
R3404:Prkd1 UTSW 12 50,695,687 (GRCm39) missense unknown
R3801:Prkd1 UTSW 12 50,430,205 (GRCm39) missense possibly damaging 0.89
R3818:Prkd1 UTSW 12 50,466,667 (GRCm39) splice site probably benign
R3906:Prkd1 UTSW 12 50,435,209 (GRCm39) missense possibly damaging 0.91
R3966:Prkd1 UTSW 12 50,439,724 (GRCm39) missense probably benign 0.44
R4179:Prkd1 UTSW 12 50,413,231 (GRCm39) missense probably damaging 1.00
R4510:Prkd1 UTSW 12 50,439,762 (GRCm39) missense possibly damaging 0.81
R4511:Prkd1 UTSW 12 50,439,762 (GRCm39) missense possibly damaging 0.81
R4663:Prkd1 UTSW 12 50,466,631 (GRCm39) splice site probably null
R4896:Prkd1 UTSW 12 50,436,745 (GRCm39) missense probably damaging 1.00
R5070:Prkd1 UTSW 12 50,441,405 (GRCm39) nonsense probably null
R5263:Prkd1 UTSW 12 50,435,089 (GRCm39) missense probably damaging 1.00
R5389:Prkd1 UTSW 12 50,389,920 (GRCm39) missense probably damaging 1.00
R5395:Prkd1 UTSW 12 50,438,215 (GRCm39) missense probably damaging 1.00
R5855:Prkd1 UTSW 12 50,439,699 (GRCm39) missense probably benign 0.03
R5967:Prkd1 UTSW 12 50,411,333 (GRCm39) missense probably damaging 0.99
R5973:Prkd1 UTSW 12 50,435,038 (GRCm39) missense probably damaging 0.99
R6052:Prkd1 UTSW 12 50,413,083 (GRCm39) critical splice donor site probably null
R6063:Prkd1 UTSW 12 50,388,826 (GRCm39) missense probably benign 0.02
R6309:Prkd1 UTSW 12 50,441,443 (GRCm39) nonsense probably null
R6518:Prkd1 UTSW 12 50,472,278 (GRCm39) missense probably benign 0.08
R6868:Prkd1 UTSW 12 50,472,320 (GRCm39) missense probably damaging 1.00
R7256:Prkd1 UTSW 12 50,435,125 (GRCm39) missense possibly damaging 0.88
R7346:Prkd1 UTSW 12 50,695,617 (GRCm39) missense possibly damaging 0.86
R7815:Prkd1 UTSW 12 50,472,300 (GRCm39) missense probably damaging 1.00
R8290:Prkd1 UTSW 12 50,388,799 (GRCm39) missense probably damaging 1.00
R8397:Prkd1 UTSW 12 50,439,675 (GRCm39) missense probably benign
R8671:Prkd1 UTSW 12 50,435,191 (GRCm39) missense probably benign 0.00
R8805:Prkd1 UTSW 12 50,435,156 (GRCm39) missense probably damaging 0.99
R8805:Prkd1 UTSW 12 50,435,155 (GRCm39) missense probably benign 0.45
R8839:Prkd1 UTSW 12 50,389,616 (GRCm39) intron probably benign
R9005:Prkd1 UTSW 12 50,430,185 (GRCm39) nonsense probably null
R9273:Prkd1 UTSW 12 50,472,232 (GRCm39) missense possibly damaging 0.94
R9281:Prkd1 UTSW 12 50,536,758 (GRCm39) missense probably benign 0.31
R9480:Prkd1 UTSW 12 50,435,283 (GRCm39) missense probably benign 0.19
R9497:Prkd1 UTSW 12 50,438,107 (GRCm39) critical splice donor site probably null
X0024:Prkd1 UTSW 12 50,536,757 (GRCm39) missense probably benign 0.31
X0062:Prkd1 UTSW 12 50,441,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTATGCTGGACTCCGCATGAC -3'
(R):5'- GCAGATCCTGCTTGAGATGTCCC -3'

Sequencing Primer
(F):5'- AGATGATATACTTCACCCTTGCAGTC -3'
(R):5'- GCAATTCACCATGCTAGAACTTAG -3'
Posted On 2013-05-09