Incidental Mutation 'R0349:Prkd1'
ID36106
Institutional Source Beutler Lab
Gene Symbol Prkd1
Ensembl Gene ENSMUSG00000002688
Gene Nameprotein kinase D1
SynonymsPrkcm, Pkcm, PKD1
MMRRC Submission 038556-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0349 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location50341231-50649098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 50366356 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 677 (L677F)
Ref Sequence ENSEMBL: ENSMUSP00000002765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002765]
Predicted Effect probably damaging
Transcript: ENSMUST00000002765
AA Change: L677F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002765
Gene: ENSMUSG00000002688
AA Change: L677F

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
C1 138 194 1.36e-12 SMART
C1 277 326 5.95e-18 SMART
PH 429 549 5.33e-9 SMART
S_TKc 589 845 1.24e-92 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase involved in many cellular processes, including Golgi body membrane integrity and transport, cell migration and differentiation, MAPK8/JNK1 and Ras pathway signaling, MAPK1/3 (ERK1/2) pathway signaling, cell survival, and regulation of cell shape and adhesion. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality. Mice homozygous for a knock-in allele display partial embryonic and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
A1cf A T 19: 31,932,662 S285C possibly damaging Het
Abcc9 A T 6: 142,664,625 N604K probably benign Het
Adgrl3 A G 5: 81,771,644 T1192A probably damaging Het
Aldh1l2 A T 10: 83,490,614 Y800N probably damaging Het
Ano3 A T 2: 110,661,487 V865D probably damaging Het
App A T 16: 85,013,680 L545Q probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
B3galnt2 T C 13: 13,991,474 V318A probably benign Het
BC005561 T C 5: 104,519,976 L788P possibly damaging Het
Clcn3 T A 8: 60,941,348 D49V possibly damaging Het
Clcn6 T A 4: 148,024,194 K126M possibly damaging Het
Cntln T A 4: 84,996,485 S510T probably damaging Het
Csk A C 9: 57,628,194 C290W probably damaging Het
Dmxl1 T A 18: 49,879,282 M1502K probably damaging Het
Dpy19l2 T A 9: 24,695,922 N81I possibly damaging Het
Dpyd T A 3: 118,917,099 C385* probably null Het
Dst G A 1: 34,199,553 V1765I probably benign Het
Eif5b A G 1: 38,032,366 S459G probably benign Het
Fam105a T A 15: 27,664,790 I27L probably benign Het
Fam83d A G 2: 158,779,848 I160V possibly damaging Het
Fat3 A G 9: 16,031,180 F1299L probably damaging Het
Fmn1 A G 2: 113,365,796 I614V unknown Het
Fsd1l T A 4: 53,679,854 V184E probably damaging Het
Fyco1 A G 9: 123,797,662 V1328A probably damaging Het
Ganab T A 19: 8,911,652 N572K probably null Het
Gbp10 T A 5: 105,221,076 D299V possibly damaging Het
Gm13078 T G 4: 143,727,059 W246G probably benign Het
Gpr83 T G 9: 14,868,267 L205R probably damaging Het
Hapln2 G A 3: 88,023,629 P152S probably damaging Het
Htatip2 T C 7: 49,773,392 Y232H probably benign Het
Itga2b C T 11: 102,467,426 V158I probably damaging Het
Kansl3 T C 1: 36,351,783 D390G probably damaging Het
Kcnh2 T C 5: 24,351,237 D16G probably benign Het
Kctd8 A T 5: 69,341,010 F98I probably damaging Het
Kif21b A T 1: 136,149,311 E357V probably damaging Het
Kmt5c C T 7: 4,746,595 R371C probably damaging Het
Kndc1 T C 7: 139,910,304 F241L probably benign Het
Lrba A G 3: 86,540,005 D2052G probably damaging Het
Lsr T A 7: 30,959,273 I54F probably damaging Het
Matk G T 10: 81,258,494 L28F probably benign Het
Mdn1 T C 4: 32,750,318 L4429P probably damaging Het
Med29 CCTGCTGCTGCTGCTGC CCTGCTGCTGCTGC 7: 28,392,510 probably benign Het
Msln G T 17: 25,750,276 Q407K possibly damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Myof A G 19: 37,910,969 I1040T probably damaging Het
Nckap5 A G 1: 126,026,434 S794P probably benign Het
Nfkbiz C T 16: 55,818,991 probably null Het
Nr2c1 C T 10: 94,195,182 S535L probably damaging Het
Olfr1448 A T 19: 12,919,935 C125S probably damaging Het
Olfr665 A T 7: 104,880,992 D95V possibly damaging Het
Olfr747 G A 14: 50,681,254 R127C probably benign Het
Opn3 A C 1: 175,692,304 L78R probably damaging Het
Pcdhb9 A G 18: 37,402,579 N542S probably damaging Het
Pdc T A 1: 150,333,427 N220K probably benign Het
Pde6c A T 19: 38,162,349 N569Y probably damaging Het
Pgm2 A T 4: 99,963,617 K219M probably damaging Het
Pitpnb C T 5: 111,347,126 T99M possibly damaging Het
Pou6f2 T A 13: 18,152,004 Q71L probably damaging Het
Ranbp17 T C 11: 33,500,689 I78V probably benign Het
Rnft2 T A 5: 118,201,385 K362M possibly damaging Het
Rprd1a T A 18: 24,506,847 E259V possibly damaging Het
Scara3 A T 14: 65,931,781 I129N probably damaging Het
Scgb1a1 A T 19: 9,085,389 probably null Het
Sec16b A T 1: 157,532,176 probably null Het
Slc18a1 A T 8: 69,072,101 M167K probably damaging Het
Slc6a15 C T 10: 103,418,225 A674V probably benign Het
Slc6a3 T C 13: 73,567,557 F437S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stag1 T A 9: 100,776,784 N141K probably damaging Het
Sun2 T C 15: 79,730,232 E321G probably damaging Het
Taar2 C A 10: 23,941,429 T289K possibly damaging Het
Taar2 T C 10: 23,941,509 Y316H probably benign Het
Tbcd T A 11: 121,602,983 probably null Het
Tecr G A 8: 83,572,275 T106I probably damaging Het
Tmem60 T G 5: 20,886,630 V131G probably benign Het
Uimc1 A G 13: 55,075,991 V156A probably benign Het
Usp28 G A 9: 49,010,281 W266* probably null Het
Vmn2r17 T A 5: 109,428,336 S358T probably damaging Het
Wwc2 T A 8: 47,868,666 Y471F unknown Het
Ythdc1 C T 5: 86,835,720 R675C probably damaging Het
Zfp30 T C 7: 29,793,604 S428P probably damaging Het
Zfp462 T A 4: 55,008,768 C245S probably benign Het
Zscan30 T C 18: 23,971,398 noncoding transcript Het
Other mutations in Prkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prkd1 APN 12 50383481 missense probably damaging 1.00
IGL00727:Prkd1 APN 12 50364661 missense probably damaging 1.00
IGL00772:Prkd1 APN 12 50383416 missense probably damaging 0.99
IGL01092:Prkd1 APN 12 50383515 splice site probably benign
IGL01457:Prkd1 APN 12 50392910 nonsense probably null
IGL01538:Prkd1 APN 12 50342142 missense probably benign
IGL01762:Prkd1 APN 12 50387230 missense probably benign 0.00
IGL01876:Prkd1 APN 12 50366348 missense probably damaging 1.00
IGL01973:Prkd1 APN 12 50366379 missense probably damaging 1.00
IGL02086:Prkd1 APN 12 50387263 missense probably benign
IGL02293:Prkd1 APN 12 50489978 missense probably damaging 0.97
IGL02454:Prkd1 APN 12 50364673 missense probably benign 0.09
IGL03309:Prkd1 APN 12 50388424 missense probably damaging 1.00
R0457:Prkd1 UTSW 12 50366372 missense probably damaging 0.99
R0627:Prkd1 UTSW 12 50490041 missense probably benign 0.00
R0899:Prkd1 UTSW 12 50385193 missense probably damaging 0.98
R1219:Prkd1 UTSW 12 50388342 missense probably damaging 1.00
R1495:Prkd1 UTSW 12 50366352 missense probably damaging 1.00
R1584:Prkd1 UTSW 12 50425515 missense probably damaging 1.00
R1665:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1666:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1668:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1669:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1735:Prkd1 UTSW 12 50342039 missense possibly damaging 0.79
R1939:Prkd1 UTSW 12 50394994 missense probably benign 0.00
R2143:Prkd1 UTSW 12 50489911 missense possibly damaging 0.77
R2145:Prkd1 UTSW 12 50489911 missense possibly damaging 0.77
R3404:Prkd1 UTSW 12 50648904 missense unknown
R3801:Prkd1 UTSW 12 50383422 missense possibly damaging 0.89
R3818:Prkd1 UTSW 12 50419884 splice site probably benign
R3906:Prkd1 UTSW 12 50388426 missense possibly damaging 0.91
R3966:Prkd1 UTSW 12 50392941 missense probably benign 0.44
R4179:Prkd1 UTSW 12 50366448 missense probably damaging 1.00
R4510:Prkd1 UTSW 12 50392979 missense possibly damaging 0.81
R4511:Prkd1 UTSW 12 50392979 missense possibly damaging 0.81
R4663:Prkd1 UTSW 12 50419848 splice site probably null
R4896:Prkd1 UTSW 12 50389962 missense probably damaging 1.00
R5070:Prkd1 UTSW 12 50394622 nonsense probably null
R5263:Prkd1 UTSW 12 50388306 missense probably damaging 1.00
R5389:Prkd1 UTSW 12 50343137 missense probably damaging 1.00
R5395:Prkd1 UTSW 12 50391432 missense probably damaging 1.00
R5855:Prkd1 UTSW 12 50392916 missense probably benign 0.03
R5967:Prkd1 UTSW 12 50364550 missense probably damaging 0.99
R5973:Prkd1 UTSW 12 50388255 missense probably damaging 0.99
R6052:Prkd1 UTSW 12 50366300 critical splice donor site probably null
R6063:Prkd1 UTSW 12 50342043 missense probably benign 0.02
R6309:Prkd1 UTSW 12 50394660 nonsense probably null
R6518:Prkd1 UTSW 12 50425495 missense probably benign 0.08
R6868:Prkd1 UTSW 12 50425537 missense probably damaging 1.00
R7256:Prkd1 UTSW 12 50388342 missense possibly damaging 0.88
R7346:Prkd1 UTSW 12 50648834 missense possibly damaging 0.86
R7815:Prkd1 UTSW 12 50425517 missense probably damaging 1.00
R8290:Prkd1 UTSW 12 50342016 missense probably damaging 1.00
R8397:Prkd1 UTSW 12 50392892 missense probably benign
X0024:Prkd1 UTSW 12 50489974 missense probably benign 0.31
X0062:Prkd1 UTSW 12 50394922 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTATGCTGGACTCCGCATGAC -3'
(R):5'- GCAGATCCTGCTTGAGATGTCCC -3'

Sequencing Primer
(F):5'- AGATGATATACTTCACCCTTGCAGTC -3'
(R):5'- GCAATTCACCATGCTAGAACTTAG -3'
Posted On2013-05-09