Incidental Mutation 'R0349:Scara3'
ID36113
Institutional Source Beutler Lab
Gene Symbol Scara3
Ensembl Gene ENSMUSG00000034463
Gene Namescavenger receptor class A, member 3
SynonymsC130058N24Rik
MMRRC Submission 038556-MU
Accession Numbers

Genbank: NM_172604; MGI: 2444418

Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R0349 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location65919394-65953935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65931781 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 129 (I129N)
Ref Sequence ENSEMBL: ENSMUSP00000046525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042046]
Predicted Effect probably damaging
Transcript: ENSMUST00000042046
AA Change: I129N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046525
Gene: ENSMUSG00000034463
AA Change: I129N

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
coiled coil region 117 155 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Collagen 455 513 3.1e-12 PFAM
Pfam:Collagen 499 558 4.2e-11 PFAM
Pfam:Collagen 544 606 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a macrophage scavenger receptor-like protein. This protein has been shown to deplete reactive oxygen species, and thus play an important role in protecting cells from oxidative stress. The expression of this gene is induced by oxidative stress. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
A1cf A T 19: 31,932,662 S285C possibly damaging Het
Abcc9 A T 6: 142,664,625 N604K probably benign Het
Adgrl3 A G 5: 81,771,644 T1192A probably damaging Het
Aldh1l2 A T 10: 83,490,614 Y800N probably damaging Het
Ano3 A T 2: 110,661,487 V865D probably damaging Het
App A T 16: 85,013,680 L545Q probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
B3galnt2 T C 13: 13,991,474 V318A probably benign Het
BC005561 T C 5: 104,519,976 L788P possibly damaging Het
Clcn3 T A 8: 60,941,348 D49V possibly damaging Het
Clcn6 T A 4: 148,024,194 K126M possibly damaging Het
Cntln T A 4: 84,996,485 S510T probably damaging Het
Csk A C 9: 57,628,194 C290W probably damaging Het
Dmxl1 T A 18: 49,879,282 M1502K probably damaging Het
Dpy19l2 T A 9: 24,695,922 N81I possibly damaging Het
Dpyd T A 3: 118,917,099 C385* probably null Het
Dst G A 1: 34,199,553 V1765I probably benign Het
Eif5b A G 1: 38,032,366 S459G probably benign Het
Fam105a T A 15: 27,664,790 I27L probably benign Het
Fam83d A G 2: 158,779,848 I160V possibly damaging Het
Fat3 A G 9: 16,031,180 F1299L probably damaging Het
Fmn1 A G 2: 113,365,796 I614V unknown Het
Fsd1l T A 4: 53,679,854 V184E probably damaging Het
Fyco1 A G 9: 123,797,662 V1328A probably damaging Het
Ganab T A 19: 8,911,652 N572K probably null Het
Gbp10 T A 5: 105,221,076 D299V possibly damaging Het
Gm13078 T G 4: 143,727,059 W246G probably benign Het
Gpr83 T G 9: 14,868,267 L205R probably damaging Het
Hapln2 G A 3: 88,023,629 P152S probably damaging Het
Htatip2 T C 7: 49,773,392 Y232H probably benign Het
Itga2b C T 11: 102,467,426 V158I probably damaging Het
Kansl3 T C 1: 36,351,783 D390G probably damaging Het
Kcnh2 T C 5: 24,351,237 D16G probably benign Het
Kctd8 A T 5: 69,341,010 F98I probably damaging Het
Kif21b A T 1: 136,149,311 E357V probably damaging Het
Kmt5c C T 7: 4,746,595 R371C probably damaging Het
Kndc1 T C 7: 139,910,304 F241L probably benign Het
Lrba A G 3: 86,540,005 D2052G probably damaging Het
Lsr T A 7: 30,959,273 I54F probably damaging Het
Matk G T 10: 81,258,494 L28F probably benign Het
Mdn1 T C 4: 32,750,318 L4429P probably damaging Het
Med29 CCTGCTGCTGCTGCTGC CCTGCTGCTGCTGC 7: 28,392,510 probably benign Het
Msln G T 17: 25,750,276 Q407K possibly damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Myof A G 19: 37,910,969 I1040T probably damaging Het
Nckap5 A G 1: 126,026,434 S794P probably benign Het
Nfkbiz C T 16: 55,818,991 probably null Het
Nr2c1 C T 10: 94,195,182 S535L probably damaging Het
Olfr1448 A T 19: 12,919,935 C125S probably damaging Het
Olfr665 A T 7: 104,880,992 D95V possibly damaging Het
Olfr747 G A 14: 50,681,254 R127C probably benign Het
Opn3 A C 1: 175,692,304 L78R probably damaging Het
Pcdhb9 A G 18: 37,402,579 N542S probably damaging Het
Pdc T A 1: 150,333,427 N220K probably benign Het
Pde6c A T 19: 38,162,349 N569Y probably damaging Het
Pgm2 A T 4: 99,963,617 K219M probably damaging Het
Pitpnb C T 5: 111,347,126 T99M possibly damaging Het
Pou6f2 T A 13: 18,152,004 Q71L probably damaging Het
Prkd1 C A 12: 50,366,356 L677F probably damaging Het
Ranbp17 T C 11: 33,500,689 I78V probably benign Het
Rnft2 T A 5: 118,201,385 K362M possibly damaging Het
Rprd1a T A 18: 24,506,847 E259V possibly damaging Het
Scgb1a1 A T 19: 9,085,389 probably null Het
Sec16b A T 1: 157,532,176 probably null Het
Slc18a1 A T 8: 69,072,101 M167K probably damaging Het
Slc6a15 C T 10: 103,418,225 A674V probably benign Het
Slc6a3 T C 13: 73,567,557 F437S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stag1 T A 9: 100,776,784 N141K probably damaging Het
Sun2 T C 15: 79,730,232 E321G probably damaging Het
Taar2 C A 10: 23,941,429 T289K possibly damaging Het
Taar2 T C 10: 23,941,509 Y316H probably benign Het
Tbcd T A 11: 121,602,983 probably null Het
Tecr G A 8: 83,572,275 T106I probably damaging Het
Tmem60 T G 5: 20,886,630 V131G probably benign Het
Uimc1 A G 13: 55,075,991 V156A probably benign Het
Usp28 G A 9: 49,010,281 W266* probably null Het
Vmn2r17 T A 5: 109,428,336 S358T probably damaging Het
Wwc2 T A 8: 47,868,666 Y471F unknown Het
Ythdc1 C T 5: 86,835,720 R675C probably damaging Het
Zfp30 T C 7: 29,793,604 S428P probably damaging Het
Zfp462 T A 4: 55,008,768 C245S probably benign Het
Zscan30 T C 18: 23,971,398 noncoding transcript Het
Other mutations in Scara3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Scara3 APN 14 65933121 missense probably benign 0.01
IGL00646:Scara3 APN 14 65921156 nonsense probably null
IGL00718:Scara3 APN 14 65931427 missense possibly damaging 0.67
IGL01948:Scara3 APN 14 65930812 missense probably damaging 0.99
IGL01979:Scara3 APN 14 65930963 missense probably benign 0.01
IGL02399:Scara3 APN 14 65933110 nonsense probably null
IGL02939:Scara3 APN 14 65931656 missense probably benign 0.00
IGL02945:Scara3 APN 14 65931211 missense probably damaging 1.00
IGL03075:Scara3 APN 14 65931154 missense probably damaging 1.00
IGL03100:Scara3 APN 14 65931273 missense probably damaging 1.00
IGL03156:Scara3 APN 14 65931154 missense probably damaging 1.00
IGL03179:Scara3 APN 14 65931154 missense probably damaging 1.00
condor UTSW 14 65931202 missense probably damaging 1.00
PIT4362001:Scara3 UTSW 14 65936402 missense probably benign
R0062:Scara3 UTSW 14 65930968 missense probably damaging 1.00
R0062:Scara3 UTSW 14 65930968 missense probably damaging 1.00
R0124:Scara3 UTSW 14 65931221 missense probably benign 0.01
R1584:Scara3 UTSW 14 65921104 missense probably damaging 1.00
R4785:Scara3 UTSW 14 65953501 start codon destroyed probably null 0.06
R5336:Scara3 UTSW 14 65931038 missense probably damaging 1.00
R6307:Scara3 UTSW 14 65938261 missense probably benign 0.24
R6420:Scara3 UTSW 14 65938252 missense possibly damaging 0.92
R6610:Scara3 UTSW 14 65931221 missense probably damaging 0.97
R7159:Scara3 UTSW 14 65920780 missense probably damaging 0.98
R7208:Scara3 UTSW 14 65931266 missense possibly damaging 0.62
R7246:Scara3 UTSW 14 65931644 missense probably damaging 0.97
R7315:Scara3 UTSW 14 65931440 missense probably damaging 1.00
R7324:Scara3 UTSW 14 65931416 missense probably benign 0.03
R7497:Scara3 UTSW 14 65931202 missense probably damaging 1.00
R7504:Scara3 UTSW 14 65931331 missense possibly damaging 0.82
R7554:Scara3 UTSW 14 65920850 missense possibly damaging 0.69
R8143:Scara3 UTSW 14 65931820 missense probably damaging 0.96
YA93:Scara3 UTSW 14 65930949 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGGAGAAGGAGCAACTGCCCATC -3'
(R):5'- AGCTCAGTCCAGAAGCCATTTGCC -3'

Sequencing Primer
(F):5'- GAGCAACTGCCCATCTCCTG -3'
(R):5'- tggaaaaggtgggtgtgg -3'
Posted On2013-05-09