Incidental Mutation 'R0349:Nfkbiz'
ID36119
Institutional Source Beutler Lab
Gene Symbol Nfkbiz
Ensembl Gene ENSMUSG00000035356
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta
SynonymsMail
MMRRC Submission 038556-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock #R0349 (G1)
Quality Score209
Status Not validated
Chromosome16
Chromosomal Location55811375-55838899 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 55818991 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036273] [ENSMUST00000096026] [ENSMUST00000114457] [ENSMUST00000114458]
Predicted Effect probably null
Transcript: ENSMUST00000036273
SMART Domains Protein: ENSMUSP00000041173
Gene: ENSMUSG00000035356

DomainStartEndE-ValueType
low complexity region 53 83 N/A INTRINSIC
low complexity region 289 315 N/A INTRINSIC
ANK 453 482 1.29e2 SMART
ANK 489 518 4.93e0 SMART
ANK 522 551 1.63e0 SMART
ANK 561 591 7.89e1 SMART
ANK 622 651 1.17e-1 SMART
ANK 658 691 2.92e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000096026
SMART Domains Protein: ENSMUSP00000093726
Gene: ENSMUSG00000035356

DomainStartEndE-ValueType
low complexity region 190 216 N/A INTRINSIC
ANK 354 383 1.29e2 SMART
ANK 390 419 4.93e0 SMART
ANK 423 452 1.63e0 SMART
ANK 462 492 7.89e1 SMART
ANK 523 552 1.17e-1 SMART
ANK 559 592 2.92e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114457
SMART Domains Protein: ENSMUSP00000110101
Gene: ENSMUSG00000035356

DomainStartEndE-ValueType
low complexity region 190 216 N/A INTRINSIC
ANK 354 383 1.29e2 SMART
ANK 390 419 4.93e0 SMART
ANK 423 452 1.63e0 SMART
ANK 462 492 7.89e1 SMART
ANK 523 552 1.17e-1 SMART
ANK 559 592 2.92e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114458
SMART Domains Protein: ENSMUSP00000110102
Gene: ENSMUSG00000035356

DomainStartEndE-ValueType
low complexity region 53 83 N/A INTRINSIC
low complexity region 289 315 N/A INTRINSIC
ANK 453 482 1.29e2 SMART
ANK 489 518 4.93e0 SMART
ANK 522 551 1.63e0 SMART
ANK 561 591 7.89e1 SMART
ANK 622 651 1.17e-1 SMART
ANK 658 691 2.92e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231463
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ankyrin-repeat family and is induced by lipopolysaccharide (LPS). The C-terminal portion of the encoded product which contains the ankyrin repeats, shares high sequence similarity with the I kappa B family of proteins. The latter are known to play a role in inflammatory responses to LPS by their interaction with NF-B proteins through ankyrin-repeat domains. Studies in mouse indicate that this gene product is one of the nuclear I kappa B proteins and an activator of IL-6 production. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene may lead to background sensitive prenatal lethality and results in abnormal cytokine secretion, higher IgE levels, ocular surface and perioral skin inflammation accompanied by hair loss, and severe atopic dermatitis-like skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
A1cf A T 19: 31,932,662 S285C possibly damaging Het
Abcc9 A T 6: 142,664,625 N604K probably benign Het
Adgrl3 A G 5: 81,771,644 T1192A probably damaging Het
Aldh1l2 A T 10: 83,490,614 Y800N probably damaging Het
Ano3 A T 2: 110,661,487 V865D probably damaging Het
App A T 16: 85,013,680 L545Q probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
B3galnt2 T C 13: 13,991,474 V318A probably benign Het
BC005561 T C 5: 104,519,976 L788P possibly damaging Het
Clcn3 T A 8: 60,941,348 D49V possibly damaging Het
Clcn6 T A 4: 148,024,194 K126M possibly damaging Het
Cntln T A 4: 84,996,485 S510T probably damaging Het
Csk A C 9: 57,628,194 C290W probably damaging Het
Dmxl1 T A 18: 49,879,282 M1502K probably damaging Het
Dpy19l2 T A 9: 24,695,922 N81I possibly damaging Het
Dpyd T A 3: 118,917,099 C385* probably null Het
Dst G A 1: 34,199,553 V1765I probably benign Het
Eif5b A G 1: 38,032,366 S459G probably benign Het
Fam105a T A 15: 27,664,790 I27L probably benign Het
Fam83d A G 2: 158,779,848 I160V possibly damaging Het
Fat3 A G 9: 16,031,180 F1299L probably damaging Het
Fmn1 A G 2: 113,365,796 I614V unknown Het
Fsd1l T A 4: 53,679,854 V184E probably damaging Het
Fyco1 A G 9: 123,797,662 V1328A probably damaging Het
Ganab T A 19: 8,911,652 N572K probably null Het
Gbp10 T A 5: 105,221,076 D299V possibly damaging Het
Gm13078 T G 4: 143,727,059 W246G probably benign Het
Gpr83 T G 9: 14,868,267 L205R probably damaging Het
Hapln2 G A 3: 88,023,629 P152S probably damaging Het
Htatip2 T C 7: 49,773,392 Y232H probably benign Het
Itga2b C T 11: 102,467,426 V158I probably damaging Het
Kansl3 T C 1: 36,351,783 D390G probably damaging Het
Kcnh2 T C 5: 24,351,237 D16G probably benign Het
Kctd8 A T 5: 69,341,010 F98I probably damaging Het
Kif21b A T 1: 136,149,311 E357V probably damaging Het
Kmt5c C T 7: 4,746,595 R371C probably damaging Het
Kndc1 T C 7: 139,910,304 F241L probably benign Het
Lrba A G 3: 86,540,005 D2052G probably damaging Het
Lsr T A 7: 30,959,273 I54F probably damaging Het
Matk G T 10: 81,258,494 L28F probably benign Het
Mdn1 T C 4: 32,750,318 L4429P probably damaging Het
Med29 CCTGCTGCTGCTGCTGC CCTGCTGCTGCTGC 7: 28,392,510 probably benign Het
Msln G T 17: 25,750,276 Q407K possibly damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Myof A G 19: 37,910,969 I1040T probably damaging Het
Nckap5 A G 1: 126,026,434 S794P probably benign Het
Nr2c1 C T 10: 94,195,182 S535L probably damaging Het
Olfr1448 A T 19: 12,919,935 C125S probably damaging Het
Olfr665 A T 7: 104,880,992 D95V possibly damaging Het
Olfr747 G A 14: 50,681,254 R127C probably benign Het
Opn3 A C 1: 175,692,304 L78R probably damaging Het
Pcdhb9 A G 18: 37,402,579 N542S probably damaging Het
Pdc T A 1: 150,333,427 N220K probably benign Het
Pde6c A T 19: 38,162,349 N569Y probably damaging Het
Pgm2 A T 4: 99,963,617 K219M probably damaging Het
Pitpnb C T 5: 111,347,126 T99M possibly damaging Het
Pou6f2 T A 13: 18,152,004 Q71L probably damaging Het
Prkd1 C A 12: 50,366,356 L677F probably damaging Het
Ranbp17 T C 11: 33,500,689 I78V probably benign Het
Rnft2 T A 5: 118,201,385 K362M possibly damaging Het
Rprd1a T A 18: 24,506,847 E259V possibly damaging Het
Scara3 A T 14: 65,931,781 I129N probably damaging Het
Scgb1a1 A T 19: 9,085,389 probably null Het
Sec16b A T 1: 157,532,176 probably null Het
Slc18a1 A T 8: 69,072,101 M167K probably damaging Het
Slc6a15 C T 10: 103,418,225 A674V probably benign Het
Slc6a3 T C 13: 73,567,557 F437S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stag1 T A 9: 100,776,784 N141K probably damaging Het
Sun2 T C 15: 79,730,232 E321G probably damaging Het
Taar2 C A 10: 23,941,429 T289K possibly damaging Het
Taar2 T C 10: 23,941,509 Y316H probably benign Het
Tbcd T A 11: 121,602,983 probably null Het
Tecr G A 8: 83,572,275 T106I probably damaging Het
Tmem60 T G 5: 20,886,630 V131G probably benign Het
Uimc1 A G 13: 55,075,991 V156A probably benign Het
Usp28 G A 9: 49,010,281 W266* probably null Het
Vmn2r17 T A 5: 109,428,336 S358T probably damaging Het
Wwc2 T A 8: 47,868,666 Y471F unknown Het
Ythdc1 C T 5: 86,835,720 R675C probably damaging Het
Zfp30 T C 7: 29,793,604 S428P probably damaging Het
Zfp462 T A 4: 55,008,768 C245S probably benign Het
Zscan30 T C 18: 23,971,398 noncoding transcript Het
Other mutations in Nfkbiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nfkbiz APN 16 55817909 missense probably benign
IGL01324:Nfkbiz APN 16 55815804 missense probably damaging 1.00
IGL02086:Nfkbiz APN 16 55815671 missense probably damaging 1.00
IGL02627:Nfkbiz APN 16 55816351 missense probably damaging 1.00
IGL02740:Nfkbiz APN 16 55817954 missense probably benign
R0539:Nfkbiz UTSW 16 55817879 missense probably benign 0.08
R0827:Nfkbiz UTSW 16 55816367 missense probably damaging 1.00
R1403:Nfkbiz UTSW 16 55816470 splice site probably benign
R1743:Nfkbiz UTSW 16 55816394 missense possibly damaging 0.82
R2090:Nfkbiz UTSW 16 55816455 missense probably benign 0.01
R2163:Nfkbiz UTSW 16 55818218 missense probably benign 0.00
R3195:Nfkbiz UTSW 16 55819628 missense probably damaging 1.00
R3974:Nfkbiz UTSW 16 55818436 missense probably benign 0.42
R4513:Nfkbiz UTSW 16 55816841 missense probably benign 0.20
R4765:Nfkbiz UTSW 16 55819024 critical splice acceptor site probably null
R4864:Nfkbiz UTSW 16 55818424 missense probably damaging 1.00
R5134:Nfkbiz UTSW 16 55818500 missense probably damaging 1.00
R5265:Nfkbiz UTSW 16 55819641 missense probably damaging 1.00
R5510:Nfkbiz UTSW 16 55814020 missense probably damaging 1.00
R6327:Nfkbiz UTSW 16 55821962 missense probably damaging 1.00
R7083:Nfkbiz UTSW 16 55818300 missense possibly damaging 0.88
R7369:Nfkbiz UTSW 16 55821846 missense probably damaging 1.00
R7650:Nfkbiz UTSW 16 55817839 missense probably benign 0.34
Z1088:Nfkbiz UTSW 16 55816438 missense probably damaging 1.00
Z1088:Nfkbiz UTSW 16 55818236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTACCACGAAGTGAGAAGGCAAC -3'
(R):5'- TGCTAACCGAGGTCCAGTTAAGTCC -3'

Sequencing Primer
(F):5'- AGCTGGCCTCTTGCAAAC -3'
(R):5'- agagagagagaaagagagagagag -3'
Posted On2013-05-09