Incidental Mutation 'R0245:Uroc1'
ID36165
Institutional Source Beutler Lab
Gene Symbol Uroc1
Ensembl Gene ENSMUSG00000034456
Gene Nameurocanase domain containing 1
Synonyms
MMRRC Submission 038483-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0245 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location90333284-90364551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90344197 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 252 (M252V)
Ref Sequence ENSEMBL: ENSMUSP00000127114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046128] [ENSMUST00000164761]
Predicted Effect probably damaging
Transcript: ENSMUST00000046128
AA Change: M252V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040424
Gene: ENSMUSG00000034456
AA Change: M252V

DomainStartEndE-ValueType
Pfam:Urocanase 84 662 2.7e-231 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164761
AA Change: M252V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127114
Gene: ENSMUSG00000034456
AA Change: M252V

DomainStartEndE-ValueType
Pfam:Urocanase 85 316 1.4e-102 PFAM
Pfam:Urocanase 319 683 8.7e-144 PFAM
Meta Mutation Damage Score 0.7887 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in histidine catabolism, metabolizing urocanic acid to formiminoglutamic acid. The gene product is known to protect the skin from ultra violet rays and is contained in human sweat. Deficiency of this gene product in the liver is an apparent cause of mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,651,429 probably benign Het
Adgrg6 T A 10: 14,458,066 probably benign Het
Adra2a G C 19: 54,047,409 V399L probably damaging Het
Arpc1b A G 5: 145,126,860 D306G probably damaging Het
Asic3 C A 5: 24,413,838 R43S probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
BC024978 T A 7: 27,200,603 C98S possibly damaging Het
Btbd2 A T 10: 80,647,806 Y178N probably damaging Het
Cacna1c T C 6: 118,604,454 N1647D probably benign Het
Cacna2d4 A T 6: 119,308,721 D803V probably damaging Het
Ccdc129 A G 6: 55,898,007 E314G probably damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Cmpk2 A T 12: 26,469,518 D56V probably benign Het
Dnah7a T C 1: 53,501,526 Y2563C probably damaging Het
Dock7 T C 4: 99,055,349 D552G possibly damaging Het
E2f7 C A 10: 110,774,795 S427* probably null Het
Eps8 T C 6: 137,479,128 D785G probably benign Het
Ereg G A 5: 91,074,800 C14Y possibly damaging Het
Fah A C 7: 84,595,498 H222Q probably benign Het
Fbxw16 T A 9: 109,436,168 S432C possibly damaging Het
Fdps A G 3: 89,093,771 S334P possibly damaging Het
Fgf7 A G 2: 126,035,955 K81E probably benign Het
Gfra1 T C 19: 58,300,554 N153S possibly damaging Het
Gm12355 T A 11: 98,625,241 probably benign Het
Golga1 A G 2: 39,035,259 V351A probably benign Het
Got1 A T 19: 43,504,507 probably benign Het
Greb1 T C 12: 16,696,456 Y1271C probably damaging Het
Gtf3c4 A G 2: 28,834,964 I252T possibly damaging Het
Gucy1a1 A G 3: 82,108,787 I298T possibly damaging Het
Hivep1 A G 13: 42,164,290 I2081V possibly damaging Het
Hps3 A T 3: 20,012,796 C535* probably null Het
Hspg2 T C 4: 137,514,722 F589S probably damaging Het
Itgb8 T A 12: 119,190,555 N249I probably damaging Het
Kdm4a T C 4: 118,175,689 D60G probably benign Het
Kng2 A T 16: 23,012,181 probably benign Het
March4 A T 1: 72,534,781 D119E probably benign Het
Mrpl34 T C 8: 71,465,075 probably benign Het
Ncoa6 C T 2: 155,391,211 G2059D probably benign Het
Nhsl1 A G 10: 18,525,108 K660R probably damaging Het
Nr2c2ap T C 8: 70,131,578 V6A possibly damaging Het
Olfr1209 C A 2: 88,909,875 D173Y possibly damaging Het
Olfr1302 A G 2: 111,780,335 N5S probably damaging Het
Olfr1404 T A 1: 173,215,957 I102N possibly damaging Het
Olfr177 A T 16: 58,872,866 Y95N probably benign Het
Olfr853 C A 9: 19,537,112 V273L probably benign Het
Oscar C T 7: 3,611,574 probably benign Het
Pkhd1 T C 1: 20,540,400 S1046G probably benign Het
Ptk6 T C 2: 181,202,491 D5G probably benign Het
Rgs12 A G 5: 35,030,080 H486R probably benign Het
Rnf111 C T 9: 70,453,831 probably benign Het
Rnf17 A G 14: 56,438,609 Y309C probably damaging Het
Rnf19a A T 15: 36,253,032 I387N probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sdk1 A G 5: 141,954,958 T494A probably benign Het
Serac1 G T 17: 6,051,756 D384E probably damaging Het
Sez6l T C 5: 112,475,566 M40V probably benign Het
Slc17a5 A G 9: 78,540,924 I416T probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Spata32 C T 11: 103,209,095 A195T probably damaging Het
Srrd A G 5: 112,337,528 probably benign Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Taok3 G A 5: 117,252,679 probably benign Het
Tbxas1 G T 6: 39,027,768 R316S probably benign Het
Tgfbrap1 A T 1: 43,075,592 I116N possibly damaging Het
Tm7sf3 T C 6: 146,618,609 T260A possibly damaging Het
Top2a T C 11: 99,010,096 I556V probably benign Het
Xpo4 G T 14: 57,630,240 H183Q probably damaging Het
Zcchc17 T A 4: 130,337,154 I81L probably benign Het
Zfp455 A T 13: 67,207,835 Y389F probably damaging Het
Other mutations in Uroc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Uroc1 APN 6 90338828 missense probably benign
IGL01015:Uroc1 APN 6 90358901 splice site probably benign
IGL01386:Uroc1 APN 6 90346765 missense probably damaging 0.99
IGL01449:Uroc1 APN 6 90338653 missense probably damaging 1.00
IGL01514:Uroc1 APN 6 90363100 splice site probably benign
IGL02060:Uroc1 APN 6 90338255 missense probably benign 0.03
IGL02247:Uroc1 APN 6 90347928 missense probably benign 0.00
IGL02256:Uroc1 APN 6 90346687 missense possibly damaging 0.83
IGL02886:Uroc1 APN 6 90346829 splice site probably benign
IGL03087:Uroc1 APN 6 90363103 splice site probably benign
PIT4651001:Uroc1 UTSW 6 90363113 nonsense probably null
R0034:Uroc1 UTSW 6 90345310 missense probably damaging 1.00
R0402:Uroc1 UTSW 6 90347302 missense probably damaging 1.00
R0570:Uroc1 UTSW 6 90338564 missense possibly damaging 0.90
R0729:Uroc1 UTSW 6 90336955 missense probably damaging 1.00
R1471:Uroc1 UTSW 6 90344171 missense probably damaging 1.00
R1782:Uroc1 UTSW 6 90336919 missense probably damaging 1.00
R1866:Uroc1 UTSW 6 90361524 missense probably benign 0.03
R1983:Uroc1 UTSW 6 90345369 missense probably damaging 1.00
R2086:Uroc1 UTSW 6 90344114 missense probably damaging 1.00
R2321:Uroc1 UTSW 6 90347247 missense possibly damaging 0.94
R3720:Uroc1 UTSW 6 90346355 missense probably damaging 1.00
R3874:Uroc1 UTSW 6 90361512 nonsense probably null
R4628:Uroc1 UTSW 6 90355328 missense probably damaging 0.99
R4810:Uroc1 UTSW 6 90363153 missense probably damaging 1.00
R4820:Uroc1 UTSW 6 90357618 critical splice donor site probably null
R4838:Uroc1 UTSW 6 90349192 missense possibly damaging 0.90
R4880:Uroc1 UTSW 6 90357537 missense probably damaging 1.00
R4964:Uroc1 UTSW 6 90345394 missense probably damaging 0.98
R4966:Uroc1 UTSW 6 90345394 missense probably damaging 0.98
R5468:Uroc1 UTSW 6 90338604 missense probably benign 0.45
R5592:Uroc1 UTSW 6 90355344 missense probably damaging 0.99
R5698:Uroc1 UTSW 6 90347320 missense probably damaging 1.00
R5789:Uroc1 UTSW 6 90344197 missense probably damaging 1.00
R5853:Uroc1 UTSW 6 90346756 missense probably damaging 0.99
R6063:Uroc1 UTSW 6 90347928 missense probably benign 0.37
R6883:Uroc1 UTSW 6 90338592 nonsense probably null
R7374:Uroc1 UTSW 6 90338833 missense probably damaging 1.00
R7394:Uroc1 UTSW 6 90345333 missense probably damaging 1.00
R7427:Uroc1 UTSW 6 90346362 missense possibly damaging 0.56
R8376:Uroc1 UTSW 6 90337715 missense probably damaging 0.99
X0021:Uroc1 UTSW 6 90344150 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ACATGTGATGAGTGGTAGGTCCCG -3'
(R):5'- GGTGCAAGCAGGACCCATGTATAG -3'

Sequencing Primer
(F):5'- TCCCGGCAGGTGGATATG -3'
(R):5'- ggaaggagaggataaaagaaggg -3'
Posted On2013-05-09