Incidental Mutation 'R0245:Greb1'
ID36188
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
MMRRC Submission 038483-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0245 (G1)
Quality Score205
Status Validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16696456 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1271 (Y1271C)
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
Predicted Effect probably damaging
Transcript: ENSMUST00000048064
AA Change: Y1271C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: Y1271C

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159120
AA Change: Y1243C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: Y1243C

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161036
Predicted Effect probably damaging
Transcript: ENSMUST00000162112
AA Change: Y1271C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: Y1271C

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Meta Mutation Damage Score 0.7847 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,651,429 probably benign Het
Adgrg6 T A 10: 14,458,066 probably benign Het
Adra2a G C 19: 54,047,409 V399L probably damaging Het
Arpc1b A G 5: 145,126,860 D306G probably damaging Het
Asic3 C A 5: 24,413,838 R43S probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
BC024978 T A 7: 27,200,603 C98S possibly damaging Het
Btbd2 A T 10: 80,647,806 Y178N probably damaging Het
Cacna1c T C 6: 118,604,454 N1647D probably benign Het
Cacna2d4 A T 6: 119,308,721 D803V probably damaging Het
Ccdc129 A G 6: 55,898,007 E314G probably damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Cmpk2 A T 12: 26,469,518 D56V probably benign Het
Dnah7a T C 1: 53,501,526 Y2563C probably damaging Het
Dock7 T C 4: 99,055,349 D552G possibly damaging Het
E2f7 C A 10: 110,774,795 S427* probably null Het
Eps8 T C 6: 137,479,128 D785G probably benign Het
Ereg G A 5: 91,074,800 C14Y possibly damaging Het
Fah A C 7: 84,595,498 H222Q probably benign Het
Fbxw16 T A 9: 109,436,168 S432C possibly damaging Het
Fdps A G 3: 89,093,771 S334P possibly damaging Het
Fgf7 A G 2: 126,035,955 K81E probably benign Het
Gfra1 T C 19: 58,300,554 N153S possibly damaging Het
Gm12355 T A 11: 98,625,241 probably benign Het
Golga1 A G 2: 39,035,259 V351A probably benign Het
Got1 A T 19: 43,504,507 probably benign Het
Gtf3c4 A G 2: 28,834,964 I252T possibly damaging Het
Gucy1a1 A G 3: 82,108,787 I298T possibly damaging Het
Hivep1 A G 13: 42,164,290 I2081V possibly damaging Het
Hps3 A T 3: 20,012,796 C535* probably null Het
Hspg2 T C 4: 137,514,722 F589S probably damaging Het
Itgb8 T A 12: 119,190,555 N249I probably damaging Het
Kdm4a T C 4: 118,175,689 D60G probably benign Het
Kng2 A T 16: 23,012,181 probably benign Het
March4 A T 1: 72,534,781 D119E probably benign Het
Mrpl34 T C 8: 71,465,075 probably benign Het
Ncoa6 C T 2: 155,391,211 G2059D probably benign Het
Nhsl1 A G 10: 18,525,108 K660R probably damaging Het
Nr2c2ap T C 8: 70,131,578 V6A possibly damaging Het
Olfr1209 C A 2: 88,909,875 D173Y possibly damaging Het
Olfr1302 A G 2: 111,780,335 N5S probably damaging Het
Olfr1404 T A 1: 173,215,957 I102N possibly damaging Het
Olfr177 A T 16: 58,872,866 Y95N probably benign Het
Olfr853 C A 9: 19,537,112 V273L probably benign Het
Oscar C T 7: 3,611,574 probably benign Het
Pkhd1 T C 1: 20,540,400 S1046G probably benign Het
Ptk6 T C 2: 181,202,491 D5G probably benign Het
Rgs12 A G 5: 35,030,080 H486R probably benign Het
Rnf111 C T 9: 70,453,831 probably benign Het
Rnf17 A G 14: 56,438,609 Y309C probably damaging Het
Rnf19a A T 15: 36,253,032 I387N probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sdk1 A G 5: 141,954,958 T494A probably benign Het
Serac1 G T 17: 6,051,756 D384E probably damaging Het
Sez6l T C 5: 112,475,566 M40V probably benign Het
Slc17a5 A G 9: 78,540,924 I416T probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Spata32 C T 11: 103,209,095 A195T probably damaging Het
Srrd A G 5: 112,337,528 probably benign Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Taok3 G A 5: 117,252,679 probably benign Het
Tbxas1 G T 6: 39,027,768 R316S probably benign Het
Tgfbrap1 A T 1: 43,075,592 I116N possibly damaging Het
Tm7sf3 T C 6: 146,618,609 T260A possibly damaging Het
Top2a T C 11: 99,010,096 I556V probably benign Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Xpo4 G T 14: 57,630,240 H183Q probably damaging Het
Zcchc17 T A 4: 130,337,154 I81L probably benign Het
Zfp455 A T 13: 67,207,835 Y389F probably damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Eared UTSW 12 16673863 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
pied_billed UTSW 12 16724857 missense possibly damaging 0.79
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense probably benign
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
R7526:Greb1 UTSW 12 16716765 missense probably benign 0.00
R7530:Greb1 UTSW 12 16717206 missense probably benign 0.02
R7536:Greb1 UTSW 12 16682185 missense probably damaging 1.00
R7643:Greb1 UTSW 12 16711996 missense probably damaging 0.99
R7732:Greb1 UTSW 12 16673863 missense probably damaging 1.00
R7740:Greb1 UTSW 12 16740121 start gained probably benign
R7747:Greb1 UTSW 12 16674795 missense probably benign 0.01
R7760:Greb1 UTSW 12 16723416 missense probably benign
R8043:Greb1 UTSW 12 16711789 missense probably damaging 1.00
R8259:Greb1 UTSW 12 16724924 nonsense probably null
Z1176:Greb1 UTSW 12 16696756 missense probably benign 0.00
Z1177:Greb1 UTSW 12 16702491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGTAAAACTGAAGACGACCC -3'
(R):5'- ACAGCCTGATTCTAGCCTCAGGAC -3'

Sequencing Primer
(F):5'- GGCATGATACCCACCTGAG -3'
(R):5'- TCGGGCTCATCATCCACAT -3'
Posted On2013-05-09