Mutagenetix > Incidental Mutation

Incidental Mutation 'R0245:Greb1'

36188

Institutional Source

Beutler Lab

Gene Symbol

Greb1

Ensembl Gene

ENSMUSG00000036523

Gene Name

gene regulated by estrogen in breast cancer protein

Synonyms

5730583K22Rik

MMRRC Submission

038483-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0245 (G1)

Quality Score

205

Status

Validated

Chromosome

Chromosomal Location

16670615-16800886 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 16696456 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1271 (Y1271C)

Ref Sequence

ENSEMBL: ENSMUSP00000124348 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]

AlphaFold

Q3UHK3

Predicted Effect

probably damaging
Transcript: ENSMUST00000048064
AA Change: Y1271C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: Y1271C

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1954	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159120
AA Change: Y1243C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: Y1243C

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1100	1118	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1596	1607	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161036

Predicted Effect

probably damaging
Transcript: ENSMUST00000162112
AA Change: Y1271C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: Y1271C

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1128	1146	N/A	INTRINSIC
low complexity region	1224	1235	N/A	INTRINSIC
low complexity region	1279	1293	N/A	INTRINSIC
low complexity region	1624	1635	N/A	INTRINSIC

Meta Mutation Damage Score

0.7847

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 96.7%
20x: 93.9%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	A	G	8: 124,651,429		probably benign	Het
Adgrg6	T	A	10: 14,458,066		probably benign	Het
Adra2a	G	C	19: 54,047,409	V399L	probably damaging	Het
Arpc1b	A	G	5: 145,126,860	D306G	probably damaging	Het
Asic3	C	A	5: 24,413,838	R43S	probably damaging	Het
Astn2	T	C	4: 65,794,558	D615G	probably damaging	Het
BC024978	T	A	7: 27,200,603	C98S	possibly damaging	Het
Btbd2	A	T	10: 80,647,806	Y178N	probably damaging	Het
Cacna1c	T	C	6: 118,604,454	N1647D	probably benign	Het
Cacna2d4	A	T	6: 119,308,721	D803V	probably damaging	Het
Ccdc129	A	G	6: 55,898,007	E314G	probably damaging	Het
Cdh26	C	T	2: 178,481,632	R675C	possibly damaging	Het
Cdx2	C	A	5: 147,306,473	K170N	possibly damaging	Het
Cmpk2	A	T	12: 26,469,518	D56V	probably benign	Het
Dnah7a	T	C	1: 53,501,526	Y2563C	probably damaging	Het
Dock7	T	C	4: 99,055,349	D552G	possibly damaging	Het
E2f7	C	A	10: 110,774,795	S427*	probably null	Het
Eps8	T	C	6: 137,479,128	D785G	probably benign	Het
Ereg	G	A	5: 91,074,800	C14Y	possibly damaging	Het
Fah	A	C	7: 84,595,498	H222Q	probably benign	Het
Fbxw16	T	A	9: 109,436,168	S432C	possibly damaging	Het
Fdps	A	G	3: 89,093,771	S334P	possibly damaging	Het
Fgf7	A	G	2: 126,035,955	K81E	probably benign	Het
Gfra1	T	C	19: 58,300,554	N153S	possibly damaging	Het
Gm12355	T	A	11: 98,625,241		probably benign	Het
Golga1	A	G	2: 39,035,259	V351A	probably benign	Het
Got1	A	T	19: 43,504,507		probably benign	Het
Gtf3c4	A	G	2: 28,834,964	I252T	possibly damaging	Het
Gucy1a1	A	G	3: 82,108,787	I298T	possibly damaging	Het
Hivep1	A	G	13: 42,164,290	I2081V	possibly damaging	Het
Hps3	A	T	3: 20,012,796	C535*	probably null	Het
Hspg2	T	C	4: 137,514,722	F589S	probably damaging	Het
Itgb8	T	A	12: 119,190,555	N249I	probably damaging	Het
Kdm4a	T	C	4: 118,175,689	D60G	probably benign	Het
Kng2	A	T	16: 23,012,181		probably benign	Het
March4	A	T	1: 72,534,781	D119E	probably benign	Het
Mrpl34	T	C	8: 71,465,075		probably benign	Het
Ncoa6	C	T	2: 155,391,211	G2059D	probably benign	Het
Nhsl1	A	G	10: 18,525,108	K660R	probably damaging	Het
Nr2c2ap	T	C	8: 70,131,578	V6A	possibly damaging	Het
Olfr1209	C	A	2: 88,909,875	D173Y	possibly damaging	Het
Olfr1302	A	G	2: 111,780,335	N5S	probably damaging	Het
Olfr1404	T	A	1: 173,215,957	I102N	possibly damaging	Het
Olfr177	A	T	16: 58,872,866	Y95N	probably benign	Het
Olfr853	C	A	9: 19,537,112	V273L	probably benign	Het
Oscar	C	T	7: 3,611,574		probably benign	Het
Pkhd1	T	C	1: 20,540,400	S1046G	probably benign	Het
Ptk6	T	C	2: 181,202,491	D5G	probably benign	Het
Rgs12	A	G	5: 35,030,080	H486R	probably benign	Het
Rnf111	C	T	9: 70,453,831		probably benign	Het
Rnf17	A	G	14: 56,438,609	Y309C	probably damaging	Het
Rnf19a	A	T	15: 36,253,032	I387N	probably damaging	Het
Safb	C	T	17: 56,606,025	R914C	probably damaging	Het
Sdk1	A	G	5: 141,954,958	T494A	probably benign	Het
Serac1	G	T	17: 6,051,756	D384E	probably damaging	Het
Sez6l	T	C	5: 112,475,566	M40V	probably benign	Het
Slc17a5	A	G	9: 78,540,924	I416T	probably benign	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Spata32	C	T	11: 103,209,095	A195T	probably damaging	Het
Srrd	A	G	5: 112,337,528		probably benign	Het
Supt3	T	C	17: 45,036,775	V208A	probably benign	Het
Taok3	G	A	5: 117,252,679		probably benign	Het
Tbxas1	G	T	6: 39,027,768	R316S	probably benign	Het
Tgfbrap1	A	T	1: 43,075,592	I116N	possibly damaging	Het
Tm7sf3	T	C	6: 146,618,609	T260A	possibly damaging	Het
Top2a	T	C	11: 99,010,096	I556V	probably benign	Het
Uroc1	A	G	6: 90,344,197	M252V	probably damaging	Het
Xpo4	G	T	14: 57,630,240	H183Q	probably damaging	Het
Zcchc17	T	A	4: 130,337,154	I81L	probably benign	Het
Zfp455	A	T	13: 67,207,835	Y389F	probably damaging	Het

Other mutations in Greb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Greb1	APN	12	16711961	missense	probably damaging	1.00
IGL01316:Greb1	APN	12	16698586	missense	probably benign	0.04
IGL01464:Greb1	APN	12	16714826	missense	probably damaging	0.99
IGL01474:Greb1	APN	12	16684501	missense	probably benign
IGL01522:Greb1	APN	12	16701201	missense	probably damaging	1.00
IGL01824:Greb1	APN	12	16711716	nonsense	probably null
IGL01837:Greb1	APN	12	16684451	missense	probably benign	0.19
IGL01991:Greb1	APN	12	16699681	missense	probably damaging	1.00
IGL01996:Greb1	APN	12	16690845	missense	possibly damaging	0.70
IGL02213:Greb1	APN	12	16706232	missense	probably damaging	1.00
IGL02267:Greb1	APN	12	16717208	missense	probably benign	0.00
IGL02512:Greb1	APN	12	16692712	missense	possibly damaging	0.79
IGL02583:Greb1	APN	12	16706295	splice site	probably benign
IGL02613:Greb1	APN	12	16739888	critical splice donor site	probably null
IGL02648:Greb1	APN	12	16708682	missense	probably damaging	1.00
IGL02679:Greb1	APN	12	16708723	missense	probably damaging	1.00
begraben	UTSW	12	16684373	missense	possibly damaging	0.51
Eared	UTSW	12	16673863	missense	probably damaging	1.00
Humpback	UTSW	12	16701171	missense	probably damaging	1.00
pied_billed	UTSW	12	16724857	missense	possibly damaging	0.79
rednecked	UTSW	12	16682152	missense	probably damaging	0.99
G1patch:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
IGL03048:Greb1	UTSW	12	16733331	missense	probably damaging	1.00
R0083:Greb1	UTSW	12	16696451	missense	probably benign
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0220:Greb1	UTSW	12	16682286	missense	probably damaging	1.00
R0540:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0547:Greb1	UTSW	12	16723411	missense	probably benign
R0563:Greb1	UTSW	12	16680267	missense	probably benign	0.23
R0607:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0610:Greb1	UTSW	12	16696442	missense	probably benign
R0652:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0659:Greb1	UTSW	12	16680212	missense	probably damaging	0.99
R0945:Greb1	UTSW	12	16673802	missense	probably benign	0.31
R1055:Greb1	UTSW	12	16682251	missense	probably damaging	0.98
R1445:Greb1	UTSW	12	16707851	missense	probably damaging	1.00
R1471:Greb1	UTSW	12	16711774	missense	probably damaging	0.97
R1503:Greb1	UTSW	12	16724819	nonsense	probably null
R1566:Greb1	UTSW	12	16711828	missense	possibly damaging	0.94
R1614:Greb1	UTSW	12	16701171	missense	probably damaging	1.00
R1623:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R1751:Greb1	UTSW	12	16723438	splice site	probably benign
R1778:Greb1	UTSW	12	16690894	missense	probably benign
R1842:Greb1	UTSW	12	16696243	missense	probably damaging	1.00
R2040:Greb1	UTSW	12	16702650	missense	probably damaging	1.00
R2153:Greb1	UTSW	12	16699532	missense	probably damaging	1.00
R2178:Greb1	UTSW	12	16696387	missense	probably damaging	1.00
R2194:Greb1	UTSW	12	16690908	missense	probably benign	0.08
R2248:Greb1	UTSW	12	16680378	missense	possibly damaging	0.90
R2474:Greb1	UTSW	12	16714953	missense	possibly damaging	0.93
R2509:Greb1	UTSW	12	16724922	missense	probably damaging	1.00
R2860:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2861:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2862:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2866:Greb1	UTSW	12	16699550	missense	probably damaging	1.00
R2890:Greb1	UTSW	12	16704478	missense	probably damaging	1.00
R3056:Greb1	UTSW	12	16688591	missense	probably damaging	0.96
R3863:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3864:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3956:Greb1	UTSW	12	16682299	missense	probably damaging	1.00
R4493:Greb1	UTSW	12	16698610	missense	probably benign	0.14
R4548:Greb1	UTSW	12	16699675	missense	probably damaging	1.00
R4683:Greb1	UTSW	12	16711773	missense	possibly damaging	0.75
R4739:Greb1	UTSW	12	16696328	missense	probably damaging	1.00
R4770:Greb1	UTSW	12	16681356	missense	probably benign	0.03
R4838:Greb1	UTSW	12	16684360	critical splice donor site	probably null
R4925:Greb1	UTSW	12	16681471	missense	probably damaging	1.00
R4982:Greb1	UTSW	12	16724761	missense	probably damaging	0.98
R5009:Greb1	UTSW	12	16724857	missense	possibly damaging	0.79
R5086:Greb1	UTSW	12	16708022	intron	probably benign
R5213:Greb1	UTSW	12	16714790	nonsense	probably null
R5310:Greb1	UTSW	12	16716759	missense	probably benign	0.09
R5353:Greb1	UTSW	12	16688566	nonsense	probably null
R5544:Greb1	UTSW	12	16673796	missense	probably damaging	1.00
R5605:Greb1	UTSW	12	16708726	missense	probably damaging	0.96
R5708:Greb1	UTSW	12	16673842	missense	probably benign	0.11
R5837:Greb1	UTSW	12	16688585	missense	probably damaging	1.00
R5890:Greb1	UTSW	12	16733421	missense	possibly damaging	0.90
R5938:Greb1	UTSW	12	16717258	missense	probably damaging	1.00
R6049:Greb1	UTSW	12	16681394	missense	probably damaging	0.99
R6093:Greb1	UTSW	12	16684486	missense	probably benign
R6120:Greb1	UTSW	12	16708621	missense	probably damaging	0.99
R6175:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R6247:Greb1	UTSW	12	16716675	missense	probably damaging	1.00
R6274:Greb1	UTSW	12	16735151	missense	probably damaging	0.97
R6376:Greb1	UTSW	12	16699579	missense	probably damaging	0.97
R6523:Greb1	UTSW	12	16684373	missense	possibly damaging	0.51
R6557:Greb1	UTSW	12	16710383	missense	probably benign	0.00
R6602:Greb1	UTSW	12	16709440	missense	probably benign	0.44
R6621:Greb1	UTSW	12	16692717	missense	probably damaging	1.00
R6645:Greb1	UTSW	12	16698579	missense	probably benign	0.07
R6725:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
R6750:Greb1	UTSW	12	16688583	missense	probably benign	0.05
R6863:Greb1	UTSW	12	16684420	missense	probably damaging	1.00
R6914:Greb1	UTSW	12	16707902	missense	probably damaging	0.97
R6996:Greb1	UTSW	12	16723354	missense	probably benign	0.00
R7083:Greb1	UTSW	12	16723314	missense	probably benign
R7147:Greb1	UTSW	12	16733427	missense	probably damaging	1.00
R7238:Greb1	UTSW	12	16674672	missense	probably damaging	0.99
R7290:Greb1	UTSW	12	16711738	missense	probably damaging	1.00
R7358:Greb1	UTSW	12	16724881	missense	probably damaging	1.00
R7395:Greb1	UTSW	12	16709430	critical splice donor site	probably null
R7526:Greb1	UTSW	12	16716765	missense	probably benign	0.00
R7530:Greb1	UTSW	12	16717206	missense	probably benign	0.02
R7536:Greb1	UTSW	12	16682185	missense	probably damaging	1.00
R7643:Greb1	UTSW	12	16711996	missense	probably damaging	0.99
R7732:Greb1	UTSW	12	16673863	missense	probably damaging	1.00
R7740:Greb1	UTSW	12	16740121	start gained	probably benign
R7747:Greb1	UTSW	12	16674795	missense	probably benign	0.01
R7760:Greb1	UTSW	12	16723416	missense	probably benign
R7937:Greb1	UTSW	12	16716669	missense	probably damaging	0.99
R8043:Greb1	UTSW	12	16711789	missense	probably damaging	1.00
R8259:Greb1	UTSW	12	16724924	nonsense	probably null
R8553:Greb1	UTSW	12	16723327	missense	probably benign	0.00
R8559:Greb1	UTSW	12	16696435	missense	probably damaging	1.00
R8690:Greb1	UTSW	12	16696547	missense	probably benign	0.03
R8830:Greb1	UTSW	12	16688519	missense	probably benign	0.35
R8911:Greb1	UTSW	12	16690902	missense	possibly damaging	0.84
R8963:Greb1	UTSW	12	16724884	missense	probably damaging	1.00
R8986:Greb1	UTSW	12	16684456	missense	probably damaging	0.99
R9013:Greb1	UTSW	12	16739969	missense	probably damaging	1.00
R9279:Greb1	UTSW	12	16682152	missense	probably damaging	0.99
R9360:Greb1	UTSW	12	16740036	missense	probably damaging	1.00
R9563:Greb1	UTSW	12	16724823	missense	probably benign	0.06
R9616:Greb1	UTSW	12	16740037	missense	probably damaging	1.00
R9627:Greb1	UTSW	12	16706166	missense	probably damaging	1.00
R9731:Greb1	UTSW	12	16688597	missense	probably damaging	1.00
R9761:Greb1	UTSW	12	16701274	missense	probably benign	0.05
Z1176:Greb1	UTSW	12	16696756	missense	probably benign	0.00
Z1177:Greb1	UTSW	12	16702491	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCAGTAAAACTGAAGACGACCC -3'
(R):5'- ACAGCCTGATTCTAGCCTCAGGAC -3'

Sequencing Primer
(F):5'- GGCATGATACCCACCTGAG -3'
(R):5'- TCGGGCTCATCATCCACAT -3'

Posted On

2013-05-09