Incidental Mutation 'R0245:Greb1'
ID 36188
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Name gene regulated by estrogen in breast cancer protein
Synonyms 5730583K22Rik
MMRRC Submission 038483-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0245 (G1)
Quality Score 205
Status Validated
Chromosome 12
Chromosomal Location 16720616-16850887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16746457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1271 (Y1271C)
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
AlphaFold Q3UHK3
Predicted Effect probably damaging
Transcript: ENSMUST00000048064
AA Change: Y1271C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: Y1271C

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159120
AA Change: Y1243C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: Y1243C

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161036
Predicted Effect probably damaging
Transcript: ENSMUST00000162112
AA Change: Y1271C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: Y1271C

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Meta Mutation Damage Score 0.7847 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 125,378,168 (GRCm39) probably benign Het
Actmap T A 7: 26,900,028 (GRCm39) C98S possibly damaging Het
Adgrg6 T A 10: 14,333,810 (GRCm39) probably benign Het
Adra2a G C 19: 54,035,840 (GRCm39) V399L probably damaging Het
Arpc1b A G 5: 145,063,670 (GRCm39) D306G probably damaging Het
Asic3 C A 5: 24,618,836 (GRCm39) R43S probably damaging Het
Astn2 T C 4: 65,712,795 (GRCm39) D615G probably damaging Het
Btbd2 A T 10: 80,483,640 (GRCm39) Y178N probably damaging Het
Cacna1c T C 6: 118,581,415 (GRCm39) N1647D probably benign Het
Cacna2d4 A T 6: 119,285,682 (GRCm39) D803V probably damaging Het
Cdh26 C T 2: 178,123,425 (GRCm39) R675C possibly damaging Het
Cdx2 C A 5: 147,243,283 (GRCm39) K170N possibly damaging Het
Cmpk2 A T 12: 26,519,517 (GRCm39) D56V probably benign Het
Dnah7a T C 1: 53,540,685 (GRCm39) Y2563C probably damaging Het
Dock7 T C 4: 98,943,586 (GRCm39) D552G possibly damaging Het
E2f7 C A 10: 110,610,656 (GRCm39) S427* probably null Het
Eps8 T C 6: 137,456,126 (GRCm39) D785G probably benign Het
Ereg G A 5: 91,222,659 (GRCm39) C14Y possibly damaging Het
Fah A C 7: 84,244,706 (GRCm39) H222Q probably benign Het
Fbxw16 T A 9: 109,265,236 (GRCm39) S432C possibly damaging Het
Fdps A G 3: 89,001,078 (GRCm39) S334P possibly damaging Het
Fgf7 A G 2: 125,877,875 (GRCm39) K81E probably benign Het
Gfra1 T C 19: 58,288,986 (GRCm39) N153S possibly damaging Het
Golga1 A G 2: 38,925,271 (GRCm39) V351A probably benign Het
Got1 A T 19: 43,492,946 (GRCm39) probably benign Het
Gtf3c4 A G 2: 28,724,976 (GRCm39) I252T possibly damaging Het
Gucy1a1 A G 3: 82,016,094 (GRCm39) I298T possibly damaging Het
Hivep1 A G 13: 42,317,766 (GRCm39) I2081V possibly damaging Het
Hps3 A T 3: 20,066,960 (GRCm39) C535* probably null Het
Hspg2 T C 4: 137,242,033 (GRCm39) F589S probably damaging Het
Itgb8 T A 12: 119,154,290 (GRCm39) N249I probably damaging Het
Itprid1 A G 6: 55,874,992 (GRCm39) E314G probably damaging Het
Kdm4a T C 4: 118,032,886 (GRCm39) D60G probably benign Het
Kng2 A T 16: 22,830,931 (GRCm39) probably benign Het
Marchf4 A T 1: 72,573,940 (GRCm39) D119E probably benign Het
Mrpl34 T C 8: 71,917,719 (GRCm39) probably benign Het
Ncoa6 C T 2: 155,233,131 (GRCm39) G2059D probably benign Het
Nhsl1 A G 10: 18,400,856 (GRCm39) K660R probably damaging Het
Nr2c2ap T C 8: 70,584,228 (GRCm39) V6A possibly damaging Het
Or10j3b T A 1: 173,043,524 (GRCm39) I102N possibly damaging Het
Or4c29 C A 2: 88,740,219 (GRCm39) D173Y possibly damaging Het
Or4k52 A G 2: 111,610,680 (GRCm39) N5S probably damaging Het
Or5k14 A T 16: 58,693,229 (GRCm39) Y95N probably benign Het
Or7g33 C A 9: 19,448,408 (GRCm39) V273L probably benign Het
Oscar C T 7: 3,614,573 (GRCm39) probably benign Het
Pkhd1 T C 1: 20,610,624 (GRCm39) S1046G probably benign Het
Ptk6 T C 2: 180,844,284 (GRCm39) D5G probably benign Het
Rgs12 A G 5: 35,187,424 (GRCm39) H486R probably benign Het
Rnf111 C T 9: 70,361,113 (GRCm39) probably benign Het
Rnf17 A G 14: 56,676,066 (GRCm39) Y309C probably damaging Het
Rnf19a A T 15: 36,253,178 (GRCm39) I387N probably damaging Het
Safb C T 17: 56,913,025 (GRCm39) R914C probably damaging Het
Sdk1 A G 5: 141,940,713 (GRCm39) T494A probably benign Het
Serac1 G T 17: 6,102,031 (GRCm39) D384E probably damaging Het
Sez6l T C 5: 112,623,432 (GRCm39) M40V probably benign Het
Slc17a5 A G 9: 78,448,206 (GRCm39) I416T probably benign Het
Snapc1 C T 12: 74,021,806 (GRCm39) R81C probably damaging Het
Spata32 C T 11: 103,099,921 (GRCm39) A195T probably damaging Het
Srrd A G 5: 112,485,394 (GRCm39) probably benign Het
Srsf3-ps T A 11: 98,516,067 (GRCm39) probably benign Het
Supt3 T C 17: 45,347,662 (GRCm39) V208A probably benign Het
Taok3 G A 5: 117,390,744 (GRCm39) probably benign Het
Tbxas1 G T 6: 39,004,702 (GRCm39) R316S probably benign Het
Tgfbrap1 A T 1: 43,114,752 (GRCm39) I116N possibly damaging Het
Tm7sf3 T C 6: 146,520,107 (GRCm39) T260A possibly damaging Het
Top2a T C 11: 98,900,922 (GRCm39) I556V probably benign Het
Uroc1 A G 6: 90,321,179 (GRCm39) M252V probably damaging Het
Xpo4 G T 14: 57,867,697 (GRCm39) H183Q probably damaging Het
Zcchc17 T A 4: 130,230,947 (GRCm39) I81L probably benign Het
Zfp455 A T 13: 67,355,899 (GRCm39) Y389F probably damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16,761,962 (GRCm39) missense probably damaging 1.00
IGL01316:Greb1 APN 12 16,748,587 (GRCm39) missense probably benign 0.04
IGL01464:Greb1 APN 12 16,764,827 (GRCm39) missense probably damaging 0.99
IGL01474:Greb1 APN 12 16,734,502 (GRCm39) missense probably benign
IGL01522:Greb1 APN 12 16,751,202 (GRCm39) missense probably damaging 1.00
IGL01824:Greb1 APN 12 16,761,717 (GRCm39) nonsense probably null
IGL01837:Greb1 APN 12 16,734,452 (GRCm39) missense probably benign 0.19
IGL01991:Greb1 APN 12 16,749,682 (GRCm39) missense probably damaging 1.00
IGL01996:Greb1 APN 12 16,740,846 (GRCm39) missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16,756,233 (GRCm39) missense probably damaging 1.00
IGL02267:Greb1 APN 12 16,767,209 (GRCm39) missense probably benign 0.00
IGL02512:Greb1 APN 12 16,742,713 (GRCm39) missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16,756,296 (GRCm39) splice site probably benign
IGL02613:Greb1 APN 12 16,789,889 (GRCm39) critical splice donor site probably null
IGL02648:Greb1 APN 12 16,758,683 (GRCm39) missense probably damaging 1.00
IGL02679:Greb1 APN 12 16,758,724 (GRCm39) missense probably damaging 1.00
begraben UTSW 12 16,734,374 (GRCm39) missense possibly damaging 0.51
Eared UTSW 12 16,723,864 (GRCm39) missense probably damaging 1.00
Humpback UTSW 12 16,751,172 (GRCm39) missense probably damaging 1.00
pied_billed UTSW 12 16,774,858 (GRCm39) missense possibly damaging 0.79
rednecked UTSW 12 16,732,153 (GRCm39) missense probably damaging 0.99
G1patch:Greb1 UTSW 12 16,738,568 (GRCm39) missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16,783,332 (GRCm39) missense probably damaging 1.00
R0083:Greb1 UTSW 12 16,746,452 (GRCm39) missense probably benign
R0100:Greb1 UTSW 12 16,730,225 (GRCm39) missense probably benign 0.41
R0100:Greb1 UTSW 12 16,730,225 (GRCm39) missense probably benign 0.41
R0220:Greb1 UTSW 12 16,732,287 (GRCm39) missense probably damaging 1.00
R0540:Greb1 UTSW 12 16,732,194 (GRCm39) missense probably damaging 1.00
R0547:Greb1 UTSW 12 16,773,412 (GRCm39) missense probably benign
R0563:Greb1 UTSW 12 16,730,268 (GRCm39) missense probably benign 0.23
R0607:Greb1 UTSW 12 16,732,194 (GRCm39) missense probably damaging 1.00
R0610:Greb1 UTSW 12 16,746,443 (GRCm39) missense probably benign
R0652:Greb1 UTSW 12 16,746,457 (GRCm39) missense probably damaging 1.00
R0659:Greb1 UTSW 12 16,730,213 (GRCm39) missense probably damaging 0.99
R0945:Greb1 UTSW 12 16,723,803 (GRCm39) missense probably benign 0.31
R1055:Greb1 UTSW 12 16,732,252 (GRCm39) missense probably damaging 0.98
R1445:Greb1 UTSW 12 16,757,852 (GRCm39) missense probably damaging 1.00
R1471:Greb1 UTSW 12 16,761,775 (GRCm39) missense probably damaging 0.97
R1503:Greb1 UTSW 12 16,774,820 (GRCm39) nonsense probably null
R1566:Greb1 UTSW 12 16,761,829 (GRCm39) missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16,751,172 (GRCm39) missense probably damaging 1.00
R1623:Greb1 UTSW 12 16,724,771 (GRCm39) missense probably damaging 1.00
R1751:Greb1 UTSW 12 16,773,439 (GRCm39) splice site probably benign
R1778:Greb1 UTSW 12 16,740,895 (GRCm39) missense probably benign
R1842:Greb1 UTSW 12 16,746,244 (GRCm39) missense probably damaging 1.00
R2040:Greb1 UTSW 12 16,752,651 (GRCm39) missense probably damaging 1.00
R2153:Greb1 UTSW 12 16,749,533 (GRCm39) missense probably damaging 1.00
R2178:Greb1 UTSW 12 16,746,388 (GRCm39) missense probably damaging 1.00
R2194:Greb1 UTSW 12 16,740,909 (GRCm39) missense probably benign 0.08
R2248:Greb1 UTSW 12 16,730,379 (GRCm39) missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16,764,954 (GRCm39) missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16,774,923 (GRCm39) missense probably damaging 1.00
R2860:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2861:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2862:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2866:Greb1 UTSW 12 16,749,551 (GRCm39) missense probably damaging 1.00
R2890:Greb1 UTSW 12 16,754,479 (GRCm39) missense probably damaging 1.00
R3056:Greb1 UTSW 12 16,738,592 (GRCm39) missense probably damaging 0.96
R3863:Greb1 UTSW 12 16,752,421 (GRCm39) missense probably damaging 1.00
R3864:Greb1 UTSW 12 16,752,421 (GRCm39) missense probably damaging 1.00
R3956:Greb1 UTSW 12 16,732,300 (GRCm39) missense probably damaging 1.00
R4493:Greb1 UTSW 12 16,748,611 (GRCm39) missense probably benign 0.14
R4548:Greb1 UTSW 12 16,749,676 (GRCm39) missense probably damaging 1.00
R4683:Greb1 UTSW 12 16,761,774 (GRCm39) missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16,746,329 (GRCm39) missense probably damaging 1.00
R4770:Greb1 UTSW 12 16,731,357 (GRCm39) missense probably benign 0.03
R4838:Greb1 UTSW 12 16,734,361 (GRCm39) critical splice donor site probably null
R4925:Greb1 UTSW 12 16,731,472 (GRCm39) missense probably damaging 1.00
R4982:Greb1 UTSW 12 16,774,762 (GRCm39) missense probably damaging 0.98
R5009:Greb1 UTSW 12 16,774,858 (GRCm39) missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16,758,023 (GRCm39) intron probably benign
R5213:Greb1 UTSW 12 16,764,791 (GRCm39) nonsense probably null
R5310:Greb1 UTSW 12 16,766,760 (GRCm39) missense probably benign 0.09
R5353:Greb1 UTSW 12 16,738,567 (GRCm39) nonsense probably null
R5544:Greb1 UTSW 12 16,723,797 (GRCm39) missense probably damaging 1.00
R5605:Greb1 UTSW 12 16,758,727 (GRCm39) missense probably damaging 0.96
R5708:Greb1 UTSW 12 16,723,843 (GRCm39) missense probably benign 0.11
R5837:Greb1 UTSW 12 16,738,586 (GRCm39) missense probably damaging 1.00
R5890:Greb1 UTSW 12 16,783,422 (GRCm39) missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16,767,259 (GRCm39) missense probably damaging 1.00
R6049:Greb1 UTSW 12 16,731,395 (GRCm39) missense probably damaging 0.99
R6093:Greb1 UTSW 12 16,734,487 (GRCm39) missense probably benign
R6120:Greb1 UTSW 12 16,758,622 (GRCm39) missense probably damaging 0.99
R6175:Greb1 UTSW 12 16,724,771 (GRCm39) missense probably damaging 1.00
R6247:Greb1 UTSW 12 16,766,676 (GRCm39) missense probably damaging 1.00
R6274:Greb1 UTSW 12 16,785,152 (GRCm39) missense probably damaging 0.97
R6376:Greb1 UTSW 12 16,749,580 (GRCm39) missense probably damaging 0.97
R6523:Greb1 UTSW 12 16,734,374 (GRCm39) missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16,760,384 (GRCm39) missense probably benign 0.00
R6602:Greb1 UTSW 12 16,759,441 (GRCm39) missense probably benign 0.44
R6621:Greb1 UTSW 12 16,742,718 (GRCm39) missense probably damaging 1.00
R6645:Greb1 UTSW 12 16,748,580 (GRCm39) missense probably benign 0.07
R6725:Greb1 UTSW 12 16,738,568 (GRCm39) missense probably damaging 1.00
R6750:Greb1 UTSW 12 16,738,584 (GRCm39) missense probably benign 0.05
R6863:Greb1 UTSW 12 16,734,421 (GRCm39) missense probably damaging 1.00
R6914:Greb1 UTSW 12 16,757,903 (GRCm39) missense probably damaging 0.97
R6996:Greb1 UTSW 12 16,773,355 (GRCm39) missense probably benign 0.00
R7083:Greb1 UTSW 12 16,773,315 (GRCm39) missense probably benign
R7147:Greb1 UTSW 12 16,783,428 (GRCm39) missense probably damaging 1.00
R7238:Greb1 UTSW 12 16,724,673 (GRCm39) missense probably damaging 0.99
R7290:Greb1 UTSW 12 16,761,739 (GRCm39) missense probably damaging 1.00
R7358:Greb1 UTSW 12 16,774,882 (GRCm39) missense probably damaging 1.00
R7395:Greb1 UTSW 12 16,759,431 (GRCm39) critical splice donor site probably null
R7526:Greb1 UTSW 12 16,766,766 (GRCm39) missense probably benign 0.00
R7530:Greb1 UTSW 12 16,767,207 (GRCm39) missense probably benign 0.02
R7536:Greb1 UTSW 12 16,732,186 (GRCm39) missense probably damaging 1.00
R7643:Greb1 UTSW 12 16,761,997 (GRCm39) missense probably damaging 0.99
R7732:Greb1 UTSW 12 16,723,864 (GRCm39) missense probably damaging 1.00
R7740:Greb1 UTSW 12 16,790,122 (GRCm39) start gained probably benign
R7747:Greb1 UTSW 12 16,724,796 (GRCm39) missense probably benign 0.01
R7760:Greb1 UTSW 12 16,773,417 (GRCm39) missense probably benign
R7937:Greb1 UTSW 12 16,766,670 (GRCm39) missense probably damaging 0.99
R8043:Greb1 UTSW 12 16,761,790 (GRCm39) missense probably damaging 1.00
R8259:Greb1 UTSW 12 16,774,925 (GRCm39) nonsense probably null
R8553:Greb1 UTSW 12 16,773,328 (GRCm39) missense probably benign 0.00
R8559:Greb1 UTSW 12 16,746,436 (GRCm39) missense probably damaging 1.00
R8690:Greb1 UTSW 12 16,746,548 (GRCm39) missense probably benign 0.03
R8830:Greb1 UTSW 12 16,738,520 (GRCm39) missense probably benign 0.35
R8911:Greb1 UTSW 12 16,740,903 (GRCm39) missense possibly damaging 0.84
R8963:Greb1 UTSW 12 16,774,885 (GRCm39) missense probably damaging 1.00
R8986:Greb1 UTSW 12 16,734,457 (GRCm39) missense probably damaging 0.99
R9013:Greb1 UTSW 12 16,789,970 (GRCm39) missense probably damaging 1.00
R9279:Greb1 UTSW 12 16,732,153 (GRCm39) missense probably damaging 0.99
R9360:Greb1 UTSW 12 16,790,037 (GRCm39) missense probably damaging 1.00
R9563:Greb1 UTSW 12 16,774,824 (GRCm39) missense probably benign 0.06
R9616:Greb1 UTSW 12 16,790,038 (GRCm39) missense probably damaging 1.00
R9627:Greb1 UTSW 12 16,756,167 (GRCm39) missense probably damaging 1.00
R9731:Greb1 UTSW 12 16,738,598 (GRCm39) missense probably damaging 1.00
R9761:Greb1 UTSW 12 16,751,275 (GRCm39) missense probably benign 0.05
Z1176:Greb1 UTSW 12 16,746,757 (GRCm39) missense probably benign 0.00
Z1177:Greb1 UTSW 12 16,752,492 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGTAAAACTGAAGACGACCC -3'
(R):5'- ACAGCCTGATTCTAGCCTCAGGAC -3'

Sequencing Primer
(F):5'- GGCATGATACCCACCTGAG -3'
(R):5'- TCGGGCTCATCATCCACAT -3'
Posted On 2013-05-09