Incidental Mutation 'R0245:Rnf17'
ID36193
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
MMRRC Submission 038483-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R0245 (G1)
Quality Score117
Status Validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56438609 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 309 (Y309C)
Ref Sequence ENSEMBL: ENSMUSP00000153222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793] [ENSMUST00000223627]
Predicted Effect probably damaging
Transcript: ENSMUST00000095793
AA Change: Y309C

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: Y309C

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223627
AA Change: Y309C

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225361
Meta Mutation Damage Score 0.2910 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,651,429 probably benign Het
Adgrg6 T A 10: 14,458,066 probably benign Het
Adra2a G C 19: 54,047,409 V399L probably damaging Het
Arpc1b A G 5: 145,126,860 D306G probably damaging Het
Asic3 C A 5: 24,413,838 R43S probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
BC024978 T A 7: 27,200,603 C98S possibly damaging Het
Btbd2 A T 10: 80,647,806 Y178N probably damaging Het
Cacna1c T C 6: 118,604,454 N1647D probably benign Het
Cacna2d4 A T 6: 119,308,721 D803V probably damaging Het
Ccdc129 A G 6: 55,898,007 E314G probably damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Cmpk2 A T 12: 26,469,518 D56V probably benign Het
Dnah7a T C 1: 53,501,526 Y2563C probably damaging Het
Dock7 T C 4: 99,055,349 D552G possibly damaging Het
E2f7 C A 10: 110,774,795 S427* probably null Het
Eps8 T C 6: 137,479,128 D785G probably benign Het
Ereg G A 5: 91,074,800 C14Y possibly damaging Het
Fah A C 7: 84,595,498 H222Q probably benign Het
Fbxw16 T A 9: 109,436,168 S432C possibly damaging Het
Fdps A G 3: 89,093,771 S334P possibly damaging Het
Fgf7 A G 2: 126,035,955 K81E probably benign Het
Gfra1 T C 19: 58,300,554 N153S possibly damaging Het
Gm12355 T A 11: 98,625,241 probably benign Het
Golga1 A G 2: 39,035,259 V351A probably benign Het
Got1 A T 19: 43,504,507 probably benign Het
Greb1 T C 12: 16,696,456 Y1271C probably damaging Het
Gtf3c4 A G 2: 28,834,964 I252T possibly damaging Het
Gucy1a1 A G 3: 82,108,787 I298T possibly damaging Het
Hivep1 A G 13: 42,164,290 I2081V possibly damaging Het
Hps3 A T 3: 20,012,796 C535* probably null Het
Hspg2 T C 4: 137,514,722 F589S probably damaging Het
Itgb8 T A 12: 119,190,555 N249I probably damaging Het
Kdm4a T C 4: 118,175,689 D60G probably benign Het
Kng2 A T 16: 23,012,181 probably benign Het
March4 A T 1: 72,534,781 D119E probably benign Het
Mrpl34 T C 8: 71,465,075 probably benign Het
Ncoa6 C T 2: 155,391,211 G2059D probably benign Het
Nhsl1 A G 10: 18,525,108 K660R probably damaging Het
Nr2c2ap T C 8: 70,131,578 V6A possibly damaging Het
Olfr1209 C A 2: 88,909,875 D173Y possibly damaging Het
Olfr1302 A G 2: 111,780,335 N5S probably damaging Het
Olfr1404 T A 1: 173,215,957 I102N possibly damaging Het
Olfr177 A T 16: 58,872,866 Y95N probably benign Het
Olfr853 C A 9: 19,537,112 V273L probably benign Het
Oscar C T 7: 3,611,574 probably benign Het
Pkhd1 T C 1: 20,540,400 S1046G probably benign Het
Ptk6 T C 2: 181,202,491 D5G probably benign Het
Rgs12 A G 5: 35,030,080 H486R probably benign Het
Rnf111 C T 9: 70,453,831 probably benign Het
Rnf19a A T 15: 36,253,032 I387N probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sdk1 A G 5: 141,954,958 T494A probably benign Het
Serac1 G T 17: 6,051,756 D384E probably damaging Het
Sez6l T C 5: 112,475,566 M40V probably benign Het
Slc17a5 A G 9: 78,540,924 I416T probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Spata32 C T 11: 103,209,095 A195T probably damaging Het
Srrd A G 5: 112,337,528 probably benign Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Taok3 G A 5: 117,252,679 probably benign Het
Tbxas1 G T 6: 39,027,768 R316S probably benign Het
Tgfbrap1 A T 1: 43,075,592 I116N possibly damaging Het
Tm7sf3 T C 6: 146,618,609 T260A possibly damaging Het
Top2a T C 11: 99,010,096 I556V probably benign Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Xpo4 G T 14: 57,630,240 H183Q probably damaging Het
Zcchc17 T A 4: 130,337,154 I81L probably benign Het
Zfp455 A T 13: 67,207,835 Y389F probably damaging Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 splice site probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56512332 splice site probably null
R7527:Rnf17 UTSW 14 56516438 missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56438878 missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56462072 critical splice donor site probably null
R7772:Rnf17 UTSW 14 56477687 missense probably benign 0.27
R8092:Rnf17 UTSW 14 56487022 missense probably benign 0.00
R8150:Rnf17 UTSW 14 56421136 missense probably benign 0.19
R8203:Rnf17 UTSW 14 56467722 missense probably benign 0.17
R8320:Rnf17 UTSW 14 56424542 frame shift probably null
R8321:Rnf17 UTSW 14 56424542 frame shift probably null
R8379:Rnf17 UTSW 14 56424542 frame shift probably null
R8380:Rnf17 UTSW 14 56424542 frame shift probably null
R8381:Rnf17 UTSW 14 56424542 frame shift probably null
R8382:Rnf17 UTSW 14 56424542 frame shift probably null
R8383:Rnf17 UTSW 14 56424542 frame shift probably null
Z1177:Rnf17 UTSW 14 56467706 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ATGATCTCAAAGGCTGCTGGAGC -3'
(R):5'- CCCAGTTGAGGCAGTACAGCAATAG -3'

Sequencing Primer
(F):5'- GAGCTTTAAGTAAGCGGTTCC -3'
(R):5'- TGAGGCAGTACAGCAATAGTCTTAG -3'
Posted On2013-05-09