Incidental Mutation 'R0245:Kng2'
ID36196
Institutional Source Beutler Lab
Gene Symbol Kng2
Ensembl Gene ENSMUSG00000060459
Gene Namekininogen 2
SynonymsKininogen-II
MMRRC Submission 038483-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0245 (G1)
Quality Score210
Status Validated
Chromosome16
Chromosomal Location22985854-23029482 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 23012181 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039338] [ENSMUST00000100046] [ENSMUST00000115349] [ENSMUST00000160243] [ENSMUST00000231835] [ENSMUST00000232459]
Predicted Effect probably benign
Transcript: ENSMUST00000039338
SMART Domains Protein: ENSMUSP00000046867
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100046
SMART Domains Protein: ENSMUSP00000097623
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 478 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115349
SMART Domains Protein: ENSMUSP00000111006
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159889
Predicted Effect probably benign
Transcript: ENSMUST00000160243
SMART Domains Protein: ENSMUSP00000124161
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
Blast:CY 140 171 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231835
Predicted Effect probably benign
Transcript: ENSMUST00000232459
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,651,429 probably benign Het
Adgrg6 T A 10: 14,458,066 probably benign Het
Adra2a G C 19: 54,047,409 V399L probably damaging Het
Arpc1b A G 5: 145,126,860 D306G probably damaging Het
Asic3 C A 5: 24,413,838 R43S probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
BC024978 T A 7: 27,200,603 C98S possibly damaging Het
Btbd2 A T 10: 80,647,806 Y178N probably damaging Het
Cacna1c T C 6: 118,604,454 N1647D probably benign Het
Cacna2d4 A T 6: 119,308,721 D803V probably damaging Het
Ccdc129 A G 6: 55,898,007 E314G probably damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Cmpk2 A T 12: 26,469,518 D56V probably benign Het
Dnah7a T C 1: 53,501,526 Y2563C probably damaging Het
Dock7 T C 4: 99,055,349 D552G possibly damaging Het
E2f7 C A 10: 110,774,795 S427* probably null Het
Eps8 T C 6: 137,479,128 D785G probably benign Het
Ereg G A 5: 91,074,800 C14Y possibly damaging Het
Fah A C 7: 84,595,498 H222Q probably benign Het
Fbxw16 T A 9: 109,436,168 S432C possibly damaging Het
Fdps A G 3: 89,093,771 S334P possibly damaging Het
Fgf7 A G 2: 126,035,955 K81E probably benign Het
Gfra1 T C 19: 58,300,554 N153S possibly damaging Het
Gm12355 T A 11: 98,625,241 probably benign Het
Golga1 A G 2: 39,035,259 V351A probably benign Het
Got1 A T 19: 43,504,507 probably benign Het
Greb1 T C 12: 16,696,456 Y1271C probably damaging Het
Gtf3c4 A G 2: 28,834,964 I252T possibly damaging Het
Gucy1a1 A G 3: 82,108,787 I298T possibly damaging Het
Hivep1 A G 13: 42,164,290 I2081V possibly damaging Het
Hps3 A T 3: 20,012,796 C535* probably null Het
Hspg2 T C 4: 137,514,722 F589S probably damaging Het
Itgb8 T A 12: 119,190,555 N249I probably damaging Het
Kdm4a T C 4: 118,175,689 D60G probably benign Het
March4 A T 1: 72,534,781 D119E probably benign Het
Mrpl34 T C 8: 71,465,075 probably benign Het
Ncoa6 C T 2: 155,391,211 G2059D probably benign Het
Nhsl1 A G 10: 18,525,108 K660R probably damaging Het
Nr2c2ap T C 8: 70,131,578 V6A possibly damaging Het
Olfr1209 C A 2: 88,909,875 D173Y possibly damaging Het
Olfr1302 A G 2: 111,780,335 N5S probably damaging Het
Olfr1404 T A 1: 173,215,957 I102N possibly damaging Het
Olfr177 A T 16: 58,872,866 Y95N probably benign Het
Olfr853 C A 9: 19,537,112 V273L probably benign Het
Oscar C T 7: 3,611,574 probably benign Het
Pkhd1 T C 1: 20,540,400 S1046G probably benign Het
Ptk6 T C 2: 181,202,491 D5G probably benign Het
Rgs12 A G 5: 35,030,080 H486R probably benign Het
Rnf111 C T 9: 70,453,831 probably benign Het
Rnf17 A G 14: 56,438,609 Y309C probably damaging Het
Rnf19a A T 15: 36,253,032 I387N probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sdk1 A G 5: 141,954,958 T494A probably benign Het
Serac1 G T 17: 6,051,756 D384E probably damaging Het
Sez6l T C 5: 112,475,566 M40V probably benign Het
Slc17a5 A G 9: 78,540,924 I416T probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Spata32 C T 11: 103,209,095 A195T probably damaging Het
Srrd A G 5: 112,337,528 probably benign Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Taok3 G A 5: 117,252,679 probably benign Het
Tbxas1 G T 6: 39,027,768 R316S probably benign Het
Tgfbrap1 A T 1: 43,075,592 I116N possibly damaging Het
Tm7sf3 T C 6: 146,618,609 T260A possibly damaging Het
Top2a T C 11: 99,010,096 I556V probably benign Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Xpo4 G T 14: 57,630,240 H183Q probably damaging Het
Zcchc17 T A 4: 130,337,154 I81L probably benign Het
Zfp455 A T 13: 67,207,835 Y389F probably damaging Het
Other mutations in Kng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Kng2 APN 16 23028830 missense probably damaging 1.00
IGL01319:Kng2 APN 16 23028834 missense probably damaging 0.99
IGL01469:Kng2 APN 16 22999827 missense probably damaging 1.00
IGL01681:Kng2 APN 16 22997017 splice site probably benign
IGL01830:Kng2 APN 16 22988051 missense probably damaging 0.97
IGL01903:Kng2 APN 16 22987790 missense possibly damaging 0.80
IGL02146:Kng2 APN 16 22987832 missense probably damaging 0.97
IGL02305:Kng2 APN 16 23000624 unclassified probably benign
IGL02429:Kng2 APN 16 23012079 missense probably damaging 0.99
FR4548:Kng2 UTSW 16 23000552 nonsense probably null
R0020:Kng2 UTSW 16 22997296 missense probably benign 0.02
R0047:Kng2 UTSW 16 22987563 missense possibly damaging 0.83
R0610:Kng2 UTSW 16 23000594 missense possibly damaging 0.96
R0646:Kng2 UTSW 16 22987736 missense probably benign 0.10
R0666:Kng2 UTSW 16 22997122 splice site probably benign
R1552:Kng2 UTSW 16 22987520 missense probably damaging 1.00
R1765:Kng2 UTSW 16 22988243 critical splice donor site probably null
R1833:Kng2 UTSW 16 23012052 missense possibly damaging 0.95
R1997:Kng2 UTSW 16 23024876 missense possibly damaging 0.84
R2025:Kng2 UTSW 16 23000575 missense probably benign 0.15
R2056:Kng2 UTSW 16 22987953 intron probably benign
R2137:Kng2 UTSW 16 22997326 intron probably benign
R2517:Kng2 UTSW 16 22988315 missense probably benign 0.24
R3438:Kng2 UTSW 16 23012071 missense probably benign 0.23
R3439:Kng2 UTSW 16 23012071 missense probably benign 0.23
R3551:Kng2 UTSW 16 23011995 critical splice donor site probably null
R4389:Kng2 UTSW 16 23024868 missense possibly damaging 0.91
R4538:Kng2 UTSW 16 22988063 missense probably benign 0.00
R4684:Kng2 UTSW 16 22987641 missense possibly damaging 0.93
R4978:Kng2 UTSW 16 22987916 missense probably damaging 1.00
R5658:Kng2 UTSW 16 22997020 splice site probably null
R6074:Kng2 UTSW 16 23000596 missense probably benign 0.03
R6216:Kng2 UTSW 16 22987593 missense probably damaging 1.00
R6271:Kng2 UTSW 16 23003948 missense probably benign 0.33
R6459:Kng2 UTSW 16 23012115 missense probably damaging 1.00
R7124:Kng2 UTSW 16 23012055 missense probably damaging 1.00
R7310:Kng2 UTSW 16 22987772 missense probably benign 0.00
R7532:Kng2 UTSW 16 23027044 splice site probably null
R7667:Kng2 UTSW 16 22988232 missense probably damaging 0.99
R7787:Kng2 UTSW 16 22999848 missense probably damaging 1.00
R8092:Kng2 UTSW 16 22987922 missense probably benign 0.00
R8165:Kng2 UTSW 16 22987496 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTCATGGAAACACGGGGCAC -3'
(R):5'- TAGCAGCGTAGACACTTCCAGACC -3'

Sequencing Primer
(F):5'- AAACCTGTCCTTGGGCAC -3'
(R):5'- ACCTTGAATATCTGAGACCCTG -3'
Posted On2013-05-09