Incidental Mutation 'R0245:Olfr177'
ID36197
Institutional Source Beutler Lab
Gene Symbol Olfr177
Ensembl Gene ENSMUSG00000063137
Gene Nameolfactory receptor 177
SynonymsGA_x54KRFPKG5P-55091371-55090442, MOR184-7
MMRRC Submission 038483-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0245 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58870955-58874768 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58872866 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 95 (Y95N)
Ref Sequence ENSEMBL: ENSMUSP00000150269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072853] [ENSMUST00000217377]
Predicted Effect probably benign
Transcript: ENSMUST00000072853
AA Change: Y95N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000072631
Gene: ENSMUSG00000063137
AA Change: Y95N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 254 8.3e-6 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205920
AA Change: Y95N
Predicted Effect probably benign
Transcript: ENSMUST00000217377
AA Change: Y95N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.0754 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,651,429 probably benign Het
Adgrg6 T A 10: 14,458,066 probably benign Het
Adra2a G C 19: 54,047,409 V399L probably damaging Het
Arpc1b A G 5: 145,126,860 D306G probably damaging Het
Asic3 C A 5: 24,413,838 R43S probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
BC024978 T A 7: 27,200,603 C98S possibly damaging Het
Btbd2 A T 10: 80,647,806 Y178N probably damaging Het
Cacna1c T C 6: 118,604,454 N1647D probably benign Het
Cacna2d4 A T 6: 119,308,721 D803V probably damaging Het
Ccdc129 A G 6: 55,898,007 E314G probably damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Cmpk2 A T 12: 26,469,518 D56V probably benign Het
Dnah7a T C 1: 53,501,526 Y2563C probably damaging Het
Dock7 T C 4: 99,055,349 D552G possibly damaging Het
E2f7 C A 10: 110,774,795 S427* probably null Het
Eps8 T C 6: 137,479,128 D785G probably benign Het
Ereg G A 5: 91,074,800 C14Y possibly damaging Het
Fah A C 7: 84,595,498 H222Q probably benign Het
Fbxw16 T A 9: 109,436,168 S432C possibly damaging Het
Fdps A G 3: 89,093,771 S334P possibly damaging Het
Fgf7 A G 2: 126,035,955 K81E probably benign Het
Gfra1 T C 19: 58,300,554 N153S possibly damaging Het
Gm12355 T A 11: 98,625,241 probably benign Het
Golga1 A G 2: 39,035,259 V351A probably benign Het
Got1 A T 19: 43,504,507 probably benign Het
Greb1 T C 12: 16,696,456 Y1271C probably damaging Het
Gtf3c4 A G 2: 28,834,964 I252T possibly damaging Het
Gucy1a1 A G 3: 82,108,787 I298T possibly damaging Het
Hivep1 A G 13: 42,164,290 I2081V possibly damaging Het
Hps3 A T 3: 20,012,796 C535* probably null Het
Hspg2 T C 4: 137,514,722 F589S probably damaging Het
Itgb8 T A 12: 119,190,555 N249I probably damaging Het
Kdm4a T C 4: 118,175,689 D60G probably benign Het
Kng2 A T 16: 23,012,181 probably benign Het
March4 A T 1: 72,534,781 D119E probably benign Het
Mrpl34 T C 8: 71,465,075 probably benign Het
Ncoa6 C T 2: 155,391,211 G2059D probably benign Het
Nhsl1 A G 10: 18,525,108 K660R probably damaging Het
Nr2c2ap T C 8: 70,131,578 V6A possibly damaging Het
Olfr1209 C A 2: 88,909,875 D173Y possibly damaging Het
Olfr1302 A G 2: 111,780,335 N5S probably damaging Het
Olfr1404 T A 1: 173,215,957 I102N possibly damaging Het
Olfr853 C A 9: 19,537,112 V273L probably benign Het
Oscar C T 7: 3,611,574 probably benign Het
Pkhd1 T C 1: 20,540,400 S1046G probably benign Het
Ptk6 T C 2: 181,202,491 D5G probably benign Het
Rgs12 A G 5: 35,030,080 H486R probably benign Het
Rnf111 C T 9: 70,453,831 probably benign Het
Rnf17 A G 14: 56,438,609 Y309C probably damaging Het
Rnf19a A T 15: 36,253,032 I387N probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sdk1 A G 5: 141,954,958 T494A probably benign Het
Serac1 G T 17: 6,051,756 D384E probably damaging Het
Sez6l T C 5: 112,475,566 M40V probably benign Het
Slc17a5 A G 9: 78,540,924 I416T probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Spata32 C T 11: 103,209,095 A195T probably damaging Het
Srrd A G 5: 112,337,528 probably benign Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Taok3 G A 5: 117,252,679 probably benign Het
Tbxas1 G T 6: 39,027,768 R316S probably benign Het
Tgfbrap1 A T 1: 43,075,592 I116N possibly damaging Het
Tm7sf3 T C 6: 146,618,609 T260A possibly damaging Het
Top2a T C 11: 99,010,096 I556V probably benign Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Xpo4 G T 14: 57,630,240 H183Q probably damaging Het
Zcchc17 T A 4: 130,337,154 I81L probably benign Het
Zfp455 A T 13: 67,207,835 Y389F probably damaging Het
Other mutations in Olfr177
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Olfr177 APN 16 58873036 missense probably damaging 1.00
IGL02223:Olfr177 APN 16 58872694 missense probably damaging 1.00
R0131:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0131:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0132:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0717:Olfr177 UTSW 16 58872770 missense probably damaging 1.00
R0975:Olfr177 UTSW 16 58873150 splice site probably null
R1037:Olfr177 UTSW 16 58872970 missense probably damaging 1.00
R1256:Olfr177 UTSW 16 58872843 nonsense probably null
R1278:Olfr177 UTSW 16 58872977 missense probably damaging 1.00
R1538:Olfr177 UTSW 16 58872898 missense probably damaging 1.00
R1992:Olfr177 UTSW 16 58872511 missense probably benign 0.43
R2173:Olfr177 UTSW 16 58872619 missense probably damaging 0.99
R2392:Olfr177 UTSW 16 58872434 missense probably damaging 1.00
R5651:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R5652:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R5653:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R8031:Olfr177 UTSW 16 58872691 missense probably benign 0.03
R8108:Olfr177 UTSW 16 58872236 missense probably benign
R8531:Olfr177 UTSW 16 58872653 missense probably damaging 1.00
R8833:Olfr177 UTSW 16 58872596 missense probably damaging 0.99
V8831:Olfr177 UTSW 16 58873075 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TTGAAGGCAGAGCTTCTTGGACATC -3'
(R):5'- GAGGACAACTACTCCTTGGCAACAG -3'

Sequencing Primer
(F):5'- AGCTTCTTGGACATCATGCTG -3'
(R):5'- TGGCAACAGAGTTCATCCTCATAG -3'
Posted On2013-05-09