Mutagenetix > Incidental Mutation

Incidental Mutation 'R0245:Safb'

36200

Institutional Source

Beutler Lab

Gene Symbol

Safb

Ensembl Gene

ENSMUSG00000071054

Gene Name

scaffold attachment factor B

Synonyms

3110021E02Rik, SAFB1, 5330423C17Rik

MMRRC Submission

038483-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.684) question?

Stock #

R0245 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56584825-56606294 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 56606025 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 914 (R914C)

Ref Sequence

ENSEMBL: ENSMUSP00000138277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052832] [ENSMUST00000095224] [ENSMUST00000182533]

AlphaFold

D3YXK2

Predicted Effect

probably benign
Transcript: ENSMUST00000052832

SMART Domains

Protein: ENSMUSP00000052908
Gene: ENSMUSG00000049760

Domain	Start	End	E-Value	Type
Pfam:QIL1	9	108	5.9e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000095224
AA Change: R912C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092849
Gene: ENSMUSG00000071054
AA Change: R912C

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
SAP	31	65	7.15e-11	SMART
coiled coil region	268	291	N/A	INTRINSIC
low complexity region	292	300	N/A	INTRINSIC
RRM	429	502	3.76e-19	SMART
coiled coil region	651	728	N/A	INTRINSIC
low complexity region	760	778	N/A	INTRINSIC
low complexity region	885	898	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182378

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182454

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182461

Predicted Effect

probably damaging
Transcript: ENSMUST00000182533
AA Change: R914C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138277
Gene: ENSMUSG00000071054
AA Change: R914C

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
SAP	31	65	7.15e-11	SMART
coiled coil region	268	291	N/A	INTRINSIC
low complexity region	292	300	N/A	INTRINSIC
RRM	429	502	3.76e-19	SMART
coiled coil region	651	728	N/A	INTRINSIC
low complexity region	760	778	N/A	INTRINSIC
low complexity region	831	842	N/A	INTRINSIC
low complexity region	887	900	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182913

Predicted Effect

probably benign
Transcript: ENSMUST00000182951

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183041

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183318

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 96.7%
20x: 93.9%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein which has high specificity for scaffold or matrix attachment region DNA elements (S/MAR DNA). This protein is thought to be involved in attaching the base of chromatin loops to the nuclear matrix but there is conflicting evidence as to whether this protein is a component of chromatin or a nuclear matrix protein. Scaffold attachment factors are a specific subset of nuclear matrix proteins (NMP) that specifically bind to S/MAR. The encoded protein is thought to serve as a molecular base to assemble a 'transcriptosome complex' in the vicinity of actively transcribed genes. It is involved in the regulation of heat shock protein 27 transcription, can act as an estrogen receptor co-repressor and is a candidate for breast tumorigenesis. This gene is arranged head-to-head with a similar gene whose product has the same functions. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mice display partial embryonic and neonatal lethality, neonatal cyanosis, impaired embryonic hematopoiesis, male sterility, azoospermia, reduced female fertility, impaired transport of embryos through the oviduct, reduced embryonic growth, testicular degeneration and ovarian atrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	A	G	8: 124,651,429		probably benign	Het
Adgrg6	T	A	10: 14,458,066		probably benign	Het
Adra2a	G	C	19: 54,047,409	V399L	probably damaging	Het
Arpc1b	A	G	5: 145,126,860	D306G	probably damaging	Het
Asic3	C	A	5: 24,413,838	R43S	probably damaging	Het
Astn2	T	C	4: 65,794,558	D615G	probably damaging	Het
BC024978	T	A	7: 27,200,603	C98S	possibly damaging	Het
Btbd2	A	T	10: 80,647,806	Y178N	probably damaging	Het
Cacna1c	T	C	6: 118,604,454	N1647D	probably benign	Het
Cacna2d4	A	T	6: 119,308,721	D803V	probably damaging	Het
Ccdc129	A	G	6: 55,898,007	E314G	probably damaging	Het
Cdh26	C	T	2: 178,481,632	R675C	possibly damaging	Het
Cdx2	C	A	5: 147,306,473	K170N	possibly damaging	Het
Cmpk2	A	T	12: 26,469,518	D56V	probably benign	Het
Dnah7a	T	C	1: 53,501,526	Y2563C	probably damaging	Het
Dock7	T	C	4: 99,055,349	D552G	possibly damaging	Het
E2f7	C	A	10: 110,774,795	S427*	probably null	Het
Eps8	T	C	6: 137,479,128	D785G	probably benign	Het
Ereg	G	A	5: 91,074,800	C14Y	possibly damaging	Het
Fah	A	C	7: 84,595,498	H222Q	probably benign	Het
Fbxw16	T	A	9: 109,436,168	S432C	possibly damaging	Het
Fdps	A	G	3: 89,093,771	S334P	possibly damaging	Het
Fgf7	A	G	2: 126,035,955	K81E	probably benign	Het
Gfra1	T	C	19: 58,300,554	N153S	possibly damaging	Het
Gm12355	T	A	11: 98,625,241		probably benign	Het
Golga1	A	G	2: 39,035,259	V351A	probably benign	Het
Got1	A	T	19: 43,504,507		probably benign	Het
Greb1	T	C	12: 16,696,456	Y1271C	probably damaging	Het
Gtf3c4	A	G	2: 28,834,964	I252T	possibly damaging	Het
Gucy1a1	A	G	3: 82,108,787	I298T	possibly damaging	Het
Hivep1	A	G	13: 42,164,290	I2081V	possibly damaging	Het
Hps3	A	T	3: 20,012,796	C535*	probably null	Het
Hspg2	T	C	4: 137,514,722	F589S	probably damaging	Het
Itgb8	T	A	12: 119,190,555	N249I	probably damaging	Het
Kdm4a	T	C	4: 118,175,689	D60G	probably benign	Het
Kng2	A	T	16: 23,012,181		probably benign	Het
March4	A	T	1: 72,534,781	D119E	probably benign	Het
Mrpl34	T	C	8: 71,465,075		probably benign	Het
Ncoa6	C	T	2: 155,391,211	G2059D	probably benign	Het
Nhsl1	A	G	10: 18,525,108	K660R	probably damaging	Het
Nr2c2ap	T	C	8: 70,131,578	V6A	possibly damaging	Het
Olfr1209	C	A	2: 88,909,875	D173Y	possibly damaging	Het
Olfr1302	A	G	2: 111,780,335	N5S	probably damaging	Het
Olfr1404	T	A	1: 173,215,957	I102N	possibly damaging	Het
Olfr177	A	T	16: 58,872,866	Y95N	probably benign	Het
Olfr853	C	A	9: 19,537,112	V273L	probably benign	Het
Oscar	C	T	7: 3,611,574		probably benign	Het
Pkhd1	T	C	1: 20,540,400	S1046G	probably benign	Het
Ptk6	T	C	2: 181,202,491	D5G	probably benign	Het
Rgs12	A	G	5: 35,030,080	H486R	probably benign	Het
Rnf111	C	T	9: 70,453,831		probably benign	Het
Rnf17	A	G	14: 56,438,609	Y309C	probably damaging	Het
Rnf19a	A	T	15: 36,253,032	I387N	probably damaging	Het
Sdk1	A	G	5: 141,954,958	T494A	probably benign	Het
Serac1	G	T	17: 6,051,756	D384E	probably damaging	Het
Sez6l	T	C	5: 112,475,566	M40V	probably benign	Het
Slc17a5	A	G	9: 78,540,924	I416T	probably benign	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Spata32	C	T	11: 103,209,095	A195T	probably damaging	Het
Srrd	A	G	5: 112,337,528		probably benign	Het
Supt3	T	C	17: 45,036,775	V208A	probably benign	Het
Taok3	G	A	5: 117,252,679		probably benign	Het
Tbxas1	G	T	6: 39,027,768	R316S	probably benign	Het
Tgfbrap1	A	T	1: 43,075,592	I116N	possibly damaging	Het
Tm7sf3	T	C	6: 146,618,609	T260A	possibly damaging	Het
Top2a	T	C	11: 99,010,096	I556V	probably benign	Het
Uroc1	A	G	6: 90,344,197	M252V	probably damaging	Het
Xpo4	G	T	14: 57,630,240	H183Q	probably damaging	Het
Zcchc17	T	A	4: 130,337,154	I81L	probably benign	Het
Zfp455	A	T	13: 67,207,835	Y389F	probably damaging	Het

Other mutations in Safb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01465:Safb	APN	17	56602974	unclassified	probably benign
IGL02391:Safb	APN	17	56600813	splice site	probably benign
IGL03145:Safb	APN	17	56605287	missense	probably damaging	1.00
R0464:Safb	UTSW	17	56606025	missense	probably damaging	1.00
R0468:Safb	UTSW	17	56606025	missense	probably damaging	1.00
R0479:Safb	UTSW	17	56606025	missense	probably damaging	1.00
R0496:Safb	UTSW	17	56605630	missense	probably benign	0.05
R0639:Safb	UTSW	17	56601092	utr 3 prime	probably benign
R0655:Safb	UTSW	17	56597803	missense	probably benign	0.23
R1109:Safb	UTSW	17	56601228	splice site	probably benign
R1941:Safb	UTSW	17	56598992	intron	probably benign
R1969:Safb	UTSW	17	56605821	missense	probably benign	0.32
R1971:Safb	UTSW	17	56605821	missense	probably benign	0.32
R4010:Safb	UTSW	17	56603765	unclassified	probably benign
R4132:Safb	UTSW	17	56600848	utr 3 prime	probably benign
R5429:Safb	UTSW	17	56588822	missense	probably benign	0.15
R5681:Safb	UTSW	17	56599000	intron	probably benign
R5900:Safb	UTSW	17	56600349	missense	unknown
R6077:Safb	UTSW	17	56602956	unclassified	probably benign
R6173:Safb	UTSW	17	56597798	missense	probably damaging	1.00
R6367:Safb	UTSW	17	56593845	unclassified	probably benign
R6735:Safb	UTSW	17	56585169	unclassified	probably benign
R6736:Safb	UTSW	17	56606023	missense	possibly damaging	0.46
R7699:Safb	UTSW	17	56601504	missense	unknown
R7834:Safb	UTSW	17	56593881	missense	unknown
R7909:Safb	UTSW	17	56595665	missense	unknown
R8167:Safb	UTSW	17	56585286	missense	unknown
R8810:Safb	UTSW	17	56603579	missense	unknown
X0065:Safb	UTSW	17	56603798	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCCAAACTGCCCACTTGGAC -3'
(R):5'- GGCTGATGGTAGAGTGCCACTTTC -3'

Sequencing Primer
(F):5'- GGCCTGGTCACATGATGAAC -3'
(R):5'- TAGGACTTGAAGGTCACGGT -3'

Posted On

2013-05-09