Incidental Mutation 'R0362:Ttbk2'
ID36209
Institutional Source Beutler Lab
Gene Symbol Ttbk2
Ensembl Gene ENSMUSG00000090100
Gene Nametau tubulin kinase 2
SynonymsB930008N24Rik, 2610507N02Rik, TTK
MMRRC Submission 038568-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0362 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120732816-120850604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120745783 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 835 (N835K)
Ref Sequence ENSEMBL: ENSMUSP00000121996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028740] [ENSMUST00000057135] [ENSMUST00000085840] [ENSMUST00000131389] [ENSMUST00000143051]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028740
AA Change: N904K

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028740
Gene: ENSMUSG00000090100
AA Change: N904K

DomainStartEndE-ValueType
Pfam:Pkinase 90 347 7e-31 PFAM
Pfam:Pkinase_Tyr 90 348 8.2e-19 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1205 1242 N/A INTRINSIC
low complexity region 1254 1271 N/A INTRINSIC
low complexity region 1285 1309 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000057135
AA Change: N835K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055032
Gene: ENSMUSG00000090100
AA Change: N835K

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085840
AA Change: N835K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000083001
Gene: ENSMUSG00000090100
AA Change: N835K

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131389
SMART Domains Protein: ENSMUSP00000118905
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 145 1.3e-18 PFAM
Pfam:Pkinase_Tyr 21 148 9.7e-12 PFAM
Pfam:Pkinase 145 239 1.2e-5 PFAM
low complexity region 265 279 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143051
AA Change: N835K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121996
Gene: ENSMUSG00000090100
AA Change: N835K

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 2.4e-32 PFAM
Pfam:Pkinase_Tyr 21 280 7.7e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148285
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (104/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit complete preweaning lethality, decreased embryo size, growth retardation, and incomplete turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,732,917 Q401R probably benign Het
Acpp A G 9: 104,314,427 F220S probably damaging Het
Adam7 A G 14: 68,509,656 probably benign Het
Adamts6 A G 13: 104,390,076 probably null Het
Ascc3 T C 10: 50,748,955 probably benign Het
Atg10 T C 13: 91,040,990 probably null Het
Atm T C 9: 53,458,838 I2325V possibly damaging Het
Btnl9 C T 11: 49,169,616 R435H possibly damaging Het
Ccdc180 A G 4: 45,923,551 K1111E probably damaging Het
Col11a2 T A 17: 34,062,446 probably null Het
Ctcfl A G 2: 173,118,443 W116R probably damaging Het
Ctsk A T 3: 95,500,944 Y37F probably damaging Het
Daam2 G C 17: 49,480,785 probably null Het
Dcdc2b T C 4: 129,610,238 probably null Het
Ddx28 C T 8: 106,011,294 R44Q probably damaging Het
Dhx29 T A 13: 112,962,859 N1139K probably benign Het
Dnah17 A T 11: 118,098,539 M1281K probably benign Het
Dnah6 T C 6: 73,208,609 S110G probably benign Het
Drc7 T C 8: 95,072,855 Y553H probably benign Het
Dync2h1 T C 9: 7,005,487 probably null Het
Ecm1 A G 3: 95,737,057 I152T possibly damaging Het
Edc4 C G 8: 105,886,775 P307R probably damaging Het
Egr1 A G 18: 34,863,313 T383A possibly damaging Het
Eml2 A G 7: 19,190,806 probably null Het
Eno4 A G 19: 58,943,624 probably benign Het
Erbb4 A T 1: 68,330,270 I404K probably damaging Het
Exoc7 G T 11: 116,295,662 T310K probably benign Het
Fam102b C T 3: 108,980,181 E256K probably benign Het
Fam83e G T 7: 45,726,969 V369L probably benign Het
Fam96b T C 8: 104,641,590 D34G probably null Het
Fancc A T 13: 63,398,156 I91K possibly damaging Het
Fbn1 T C 2: 125,309,777 Q2519R probably damaging Het
Fhod3 T A 18: 25,090,076 C826* probably null Het
Foxi3 A G 6: 70,956,628 D33G probably benign Het
Gcn1l1 T C 5: 115,576,108 probably benign Het
Gm14221 T C 2: 160,568,390 noncoding transcript Het
Golga4 T A 9: 118,555,785 H630Q probably benign Het
Gpat4 T C 8: 23,180,933 S88G probably benign Het
Gucy2d A T 7: 98,443,685 S90C probably damaging Het
Has2 A C 15: 56,681,661 C182G probably damaging Het
Heatr5a A T 12: 51,888,861 S1647R probably damaging Het
Ifi35 T C 11: 101,457,212 V48A probably benign Het
Lig1 T A 7: 13,296,804 probably benign Het
Magi2 A G 5: 19,227,575 K96R probably damaging Het
Map7d1 G T 4: 126,234,994 P462Q probably damaging Het
Mdn1 A T 4: 32,746,439 probably null Het
Mfsd4a A T 1: 132,059,275 V105E probably damaging Het
Mrpl53 C T 6: 83,109,545 R77C probably damaging Het
Mtnr1b C T 9: 15,874,304 V53M probably damaging Het
Myo9b T C 8: 71,347,770 W990R probably damaging Het
Myt1 A T 2: 181,763,393 probably benign Het
Nf1 C T 11: 79,536,878 A1766V probably damaging Het
Nlrp3 T C 11: 59,548,797 V400A possibly damaging Het
Nup205 T A 6: 35,196,714 probably null Het
Nxf1 T C 19: 8,764,151 probably null Het
Olfr1352 A T 10: 78,984,386 M199L probably benign Het
P4hb T C 11: 120,563,336 K311E probably benign Het
Pafah1b1 T C 11: 74,683,631 N243S probably benign Het
Parp8 G A 13: 116,924,968 Q141* probably null Het
Pkd2l2 A C 18: 34,435,327 D543A probably benign Het
Pld5 A T 1: 175,975,580 L311* probably null Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plpp5 A T 8: 25,724,192 T144S probably benign Het
Ppp6r3 A G 19: 3,478,285 L542S probably damaging Het
Prkar2b A T 12: 31,987,974 probably null Het
Psmg1 A T 16: 95,987,971 S129T possibly damaging Het
Radil T C 5: 142,543,827 D38G probably benign Het
Ric1 T C 19: 29,601,011 probably null Het
Rp1l1 T A 14: 64,031,066 L1367* probably null Het
Rxfp1 A T 3: 79,737,793 M1K probably null Het
Serpina6 G T 12: 103,651,949 L202I probably damaging Het
Simc1 T C 13: 54,528,467 I98T probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Slc26a11 T A 11: 119,379,941 probably benign Het
Slc34a1 T A 13: 55,402,898 probably null Het
Slfn10-ps T A 11: 83,035,774 noncoding transcript Het
Sohlh2 A G 3: 55,207,742 N383D probably damaging Het
Spag6 T A 2: 18,710,491 L27H probably damaging Het
Sptlc3 A G 2: 139,546,555 probably benign Het
St3gal4 T A 9: 35,053,173 K199* probably null Het
Stat5a T A 11: 100,882,083 D712E probably benign Het
Stmn2 A T 3: 8,545,690 D78V probably damaging Het
Stpg1 C T 4: 135,506,466 P20S possibly damaging Het
Taf2 A T 15: 55,045,929 V640E probably damaging Het
Tbce T C 13: 13,998,162 E501G probably benign Het
Tecpr2 A G 12: 110,968,940 S1398G probably damaging Het
Tenm4 T A 7: 96,772,035 Y598* probably null Het
Ticrr A G 7: 79,677,340 S599G probably damaging Het
Tnc A C 4: 64,017,442 V419G probably damaging Het
Trappc1 C A 11: 69,325,576 P110T probably benign Het
Trbv12-2 C T 6: 41,119,059 probably benign Het
Tubgcp5 A G 7: 55,800,684 D181G probably damaging Het
Tut1 T C 19: 8,955,527 Y75H possibly damaging Het
Ulk2 C A 11: 61,787,586 C769F probably benign Het
Vdac1 T C 11: 52,374,973 probably benign Het
Vmn2r124 T C 17: 18,064,224 probably null Het
Vps8 T C 16: 21,608,227 probably benign Het
Wdr35 T C 12: 8,995,625 probably benign Het
Zdhhc7 T A 8: 120,086,647 E141V probably null Het
Zfp12 C A 5: 143,245,223 S435Y probably damaging Het
Zfp974 A T 7: 27,927,394 probably benign Het
Zfyve9 T A 4: 108,680,969 K1033N probably damaging Het
Zswim8 T A 14: 20,721,945 S1572T possibly damaging Het
Other mutations in Ttbk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ttbk2 APN 2 120748833 nonsense probably null
IGL00484:Ttbk2 APN 2 120773886 nonsense probably null
IGL00767:Ttbk2 APN 2 120745745 missense probably benign
IGL00809:Ttbk2 APN 2 120760269 missense probably damaging 1.00
IGL01484:Ttbk2 APN 2 120739833 missense possibly damaging 0.95
IGL01974:Ttbk2 APN 2 120786083 missense probably damaging 1.00
IGL02488:Ttbk2 APN 2 120755871 missense probably benign 0.00
IGL02874:Ttbk2 APN 2 120745712 missense probably damaging 0.99
IGL02893:Ttbk2 APN 2 120783729 missense probably damaging 1.00
IGL03210:Ttbk2 APN 2 120822492 missense probably damaging 0.99
R0279:Ttbk2 UTSW 2 120748960 missense probably benign 0.00
R0376:Ttbk2 UTSW 2 120777581 missense probably damaging 1.00
R0400:Ttbk2 UTSW 2 120750242 missense probably benign 0.02
R0601:Ttbk2 UTSW 2 120825296 missense possibly damaging 0.73
R0606:Ttbk2 UTSW 2 120773872 missense probably damaging 1.00
R0664:Ttbk2 UTSW 2 120748821 missense probably damaging 0.99
R0718:Ttbk2 UTSW 2 120745160 missense probably benign 0.00
R0718:Ttbk2 UTSW 2 120748575 missense probably benign 0.01
R0783:Ttbk2 UTSW 2 120739977 missense possibly damaging 0.74
R0906:Ttbk2 UTSW 2 120783781 missense probably damaging 1.00
R1141:Ttbk2 UTSW 2 120806851 missense probably damaging 1.00
R1363:Ttbk2 UTSW 2 120806908 critical splice acceptor site probably null
R1420:Ttbk2 UTSW 2 120745912 missense probably benign 0.00
R1734:Ttbk2 UTSW 2 120755838 missense probably benign 0.01
R2033:Ttbk2 UTSW 2 120806849 missense probably damaging 0.98
R2047:Ttbk2 UTSW 2 120748916 missense probably damaging 0.99
R2893:Ttbk2 UTSW 2 120745610 unclassified probably null
R3783:Ttbk2 UTSW 2 120773815 splice site probably benign
R3785:Ttbk2 UTSW 2 120773815 splice site probably benign
R3870:Ttbk2 UTSW 2 120740019 missense probably damaging 1.00
R4024:Ttbk2 UTSW 2 120760255 missense possibly damaging 0.91
R4039:Ttbk2 UTSW 2 120745795 missense probably benign 0.01
R4060:Ttbk2 UTSW 2 120748984 missense probably benign 0.26
R4624:Ttbk2 UTSW 2 120773323 missense probably benign 0.19
R4634:Ttbk2 UTSW 2 120740192 missense probably damaging 1.00
R4708:Ttbk2 UTSW 2 120739861 missense probably damaging 1.00
R4727:Ttbk2 UTSW 2 120745370 missense probably benign 0.01
R4811:Ttbk2 UTSW 2 120740070 missense possibly damaging 0.62
R4962:Ttbk2 UTSW 2 120745150 missense probably damaging 1.00
R4964:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R4966:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R5369:Ttbk2 UTSW 2 120825262 start gained probably benign
R5430:Ttbk2 UTSW 2 120777565 missense probably damaging 1.00
R5607:Ttbk2 UTSW 2 120806824 missense possibly damaging 0.89
R5812:Ttbk2 UTSW 2 120822559 missense probably damaging 0.99
R5898:Ttbk2 UTSW 2 120745040 missense probably benign 0.08
R5951:Ttbk2 UTSW 2 120773283 missense probably benign 0.02
R6135:Ttbk2 UTSW 2 120750317 missense probably damaging 1.00
R6889:Ttbk2 UTSW 2 120773353 missense probably damaging 1.00
R6907:Ttbk2 UTSW 2 120825270 missense probably benign 0.00
R7013:Ttbk2 UTSW 2 120745784 missense possibly damaging 0.89
R7128:Ttbk2 UTSW 2 120746088 missense probably benign 0.00
R7173:Ttbk2 UTSW 2 120740111 missense probably damaging 1.00
R7358:Ttbk2 UTSW 2 120790310 missense probably damaging 1.00
R7475:Ttbk2 UTSW 2 120748640 missense probably benign 0.01
RF010:Ttbk2 UTSW 2 120790339 nonsense probably null
RF021:Ttbk2 UTSW 2 120748634 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGCCTTGGCAAGCTTTCAC -3'
(R):5'- TTGGGACCAAAAGACCCTCCTGAC -3'

Sequencing Primer
(F):5'- GGCAAGCTTTCACTCTGAATAC -3'
(R):5'- TTTGAACATCTCCCTGGAGAAACAG -3'
Posted On2013-05-09